ID: 1164179638

View in Genome Browser
Species Human (GRCh38)
Location 19:22807476-22807498
Sequence GCGAGTGGGGAGGAACCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179638_1164179644 -3 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179638_1164179653 19 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179653 19:22807518-22807540 GCTCTGTGGCCCGGGCTCCAAGG No data
1164179638_1164179646 5 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179646 19:22807504-22807526 TCCAGCCCCGCGCGGCTCTGTGG No data
1164179638_1164179651 11 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179638_1164179655 23 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179655 19:22807522-22807544 TGTGGCCCGGGCTCCAAGGCGGG No data
1164179638_1164179649 10 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179649 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
1164179638_1164179657 25 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179638_1164179654 22 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179654 19:22807521-22807543 CTGTGGCCCGGGCTCCAAGGCGG No data
1164179638_1164179656 24 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179656 19:22807523-22807545 GTGGCCCGGGCTCCAAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179638 Original CRISPR GCGAGTGGGGAGGAACCAGC GGG (reversed) Intergenic