ID: 1164179643

View in Genome Browser
Species Human (GRCh38)
Location 19:22807491-22807513
Sequence CGGGGCTGGAGAGCGGCGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179643_1164179661 23 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179643_1164179653 4 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179653 19:22807518-22807540 GCTCTGTGGCCCGGGCTCCAAGG No data
1164179643_1164179651 -4 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179643_1164179646 -10 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179646 19:22807504-22807526 TCCAGCCCCGCGCGGCTCTGTGG No data
1164179643_1164179656 9 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179656 19:22807523-22807545 GTGGCCCGGGCTCCAAGGCGGGG No data
1164179643_1164179657 10 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179643_1164179655 8 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179655 19:22807522-22807544 TGTGGCCCGGGCTCCAAGGCGGG No data
1164179643_1164179649 -5 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179649 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
1164179643_1164179662 30 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179643_1164179654 7 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179654 19:22807521-22807543 CTGTGGCCCGGGCTCCAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179643 Original CRISPR CGGGGCTGGAGAGCGGCGAG TGG (reversed) Intergenic