ID: 1164179644

View in Genome Browser
Species Human (GRCh38)
Location 19:22807496-22807518
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179636_1164179644 3 Left 1164179636 19:22807470-22807492 CCTCCGCCCGCTGGTTCCTCCCC No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179633_1164179644 8 Left 1164179633 19:22807465-22807487 CCCCTCCTCCGCCCGCTGGTTCC No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179639_1164179644 -4 Left 1164179639 19:22807477-22807499 CCGCTGGTTCCTCCCCACTCGCC No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179630_1164179644 20 Left 1164179630 19:22807453-22807475 CCTGCAGGGCCGCCCCTCCTCCG 0: 2
1: 2
2: 4
3: 57
4: 394
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179635_1164179644 6 Left 1164179635 19:22807467-22807489 CCTCCTCCGCCCGCTGGTTCCTC No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179632_1164179644 11 Left 1164179632 19:22807462-22807484 CCGCCCCTCCTCCGCCCGCTGGT 0: 2
1: 1
2: 1
3: 56
4: 543
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179638_1164179644 -3 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179629_1164179644 28 Left 1164179629 19:22807445-22807467 CCGCGTCGCCTGCAGGGCCGCCC 0: 3
1: 0
2: 2
3: 14
4: 195
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179634_1164179644 7 Left 1164179634 19:22807466-22807488 CCCTCCTCCGCCCGCTGGTTCCT No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179628_1164179644 29 Left 1164179628 19:22807444-22807466 CCCGCGTCGCCTGCAGGGCCGCC 0: 3
1: 0
2: 2
3: 23
4: 194
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179637_1164179644 0 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data
1164179627_1164179644 30 Left 1164179627 19:22807443-22807465 CCCCGCGTCGCCTGCAGGGCCGC 0: 3
1: 0
2: 1
3: 8
4: 123
Right 1164179644 19:22807496-22807518 CGCCGCTCTCCAGCCCCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179644 Original CRISPR CGCCGCTCTCCAGCCCCGCG CGG Intergenic
No off target data available for this crispr