ID: 1164179645

View in Genome Browser
Species Human (GRCh38)
Location 19:22807498-22807520
Sequence AGCCGCGCGGGGCTGGAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179645_1164179664 27 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179664 19:22807548-22807570 CGCCCACGACGGCCACCGGCAGG No data
1164179645_1164179654 0 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179654 19:22807521-22807543 CTGTGGCCCGGGCTCCAAGGCGG No data
1164179645_1164179665 28 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179665 19:22807549-22807571 GCCCACGACGGCCACCGGCAGGG No data
1164179645_1164179653 -3 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179653 19:22807518-22807540 GCTCTGTGGCCCGGGCTCCAAGG No data
1164179645_1164179657 3 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179645_1164179655 1 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179655 19:22807522-22807544 TGTGGCCCGGGCTCCAAGGCGGG No data
1164179645_1164179662 23 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179645_1164179661 16 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179645_1164179656 2 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179656 19:22807523-22807545 GTGGCCCGGGCTCCAAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179645 Original CRISPR AGCCGCGCGGGGCTGGAGAG CGG (reversed) Intergenic