ID: 1164179647

View in Genome Browser
Species Human (GRCh38)
Location 19:22807505-22807527
Sequence GCCACAGAGCCGCGCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179647_1164179668 28 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179668 19:22807556-22807578 ACGGCCACCGGCAGGGACAGCGG No data
1164179647_1164179655 -6 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179655 19:22807522-22807544 TGTGGCCCGGGCTCCAAGGCGGG No data
1164179647_1164179665 21 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179665 19:22807549-22807571 GCCCACGACGGCCACCGGCAGGG No data
1164179647_1164179656 -5 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179656 19:22807523-22807545 GTGGCCCGGGCTCCAAGGCGGGG No data
1164179647_1164179669 29 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179669 19:22807557-22807579 CGGCCACCGGCAGGGACAGCGGG No data
1164179647_1164179661 9 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179647_1164179654 -7 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179654 19:22807521-22807543 CTGTGGCCCGGGCTCCAAGGCGG No data
1164179647_1164179670 30 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data
1164179647_1164179664 20 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179664 19:22807548-22807570 CGCCCACGACGGCCACCGGCAGG No data
1164179647_1164179653 -10 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179653 19:22807518-22807540 GCTCTGTGGCCCGGGCTCCAAGG No data
1164179647_1164179657 -4 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179647_1164179662 16 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179647 Original CRISPR GCCACAGAGCCGCGCGGGGC TGG (reversed) Intergenic
No off target data available for this crispr