ID: 1164179648

View in Genome Browser
Species Human (GRCh38)
Location 19:22807509-22807531
Sequence CCGGGCCACAGAGCCGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179648_1164179665 17 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179665 19:22807549-22807571 GCCCACGACGGCCACCGGCAGGG No data
1164179648_1164179661 5 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179648_1164179656 -9 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179656 19:22807523-22807545 GTGGCCCGGGCTCCAAGGCGGGG No data
1164179648_1164179655 -10 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179655 19:22807522-22807544 TGTGGCCCGGGCTCCAAGGCGGG No data
1164179648_1164179657 -8 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179648_1164179671 27 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179671 19:22807559-22807581 GCCACCGGCAGGGACAGCGGGGG No data
1164179648_1164179664 16 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179664 19:22807548-22807570 CGCCCACGACGGCCACCGGCAGG No data
1164179648_1164179668 24 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179668 19:22807556-22807578 ACGGCCACCGGCAGGGACAGCGG No data
1164179648_1164179669 25 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179669 19:22807557-22807579 CGGCCACCGGCAGGGACAGCGGG No data
1164179648_1164179662 12 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179648_1164179670 26 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179648 Original CRISPR CCGGGCCACAGAGCCGCGCG GGG (reversed) Intergenic
No off target data available for this crispr