ID: 1164179651

View in Genome Browser
Species Human (GRCh38)
Location 19:22807510-22807532
Sequence CCCGCGCGGCTCTGTGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179636_1164179651 17 Left 1164179636 19:22807470-22807492 CCTCCGCCCGCTGGTTCCTCCCC No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179640_1164179651 1 Left 1164179640 19:22807486-22807508 CCTCCCCACTCGCCGCTCTCCAG No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179632_1164179651 25 Left 1164179632 19:22807462-22807484 CCGCCCCTCCTCCGCCCGCTGGT No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179639_1164179651 10 Left 1164179639 19:22807477-22807499 CCGCTGGTTCCTCCCCACTCGCC No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179643_1164179651 -4 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179635_1164179651 20 Left 1164179635 19:22807467-22807489 CCTCCTCCGCCCGCTGGTTCCTC No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179638_1164179651 11 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179633_1164179651 22 Left 1164179633 19:22807465-22807487 CCCCTCCTCCGCCCGCTGGTTCC No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179642_1164179651 -3 Left 1164179642 19:22807490-22807512 CCCACTCGCCGCTCTCCAGCCCC No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179641_1164179651 -2 Left 1164179641 19:22807489-22807511 CCCCACTCGCCGCTCTCCAGCCC No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179637_1164179651 14 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
1164179634_1164179651 21 Left 1164179634 19:22807466-22807488 CCCTCCTCCGCCCGCTGGTTCCT No data
Right 1164179651 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179651 Original CRISPR CCCGCGCGGCTCTGTGGCCC GGG Intergenic