ID: 1164179652

View in Genome Browser
Species Human (GRCh38)
Location 19:22807511-22807533
Sequence GCCCGGGCCACAGAGCCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179652_1164179664 14 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179664 19:22807548-22807570 CGCCCACGACGGCCACCGGCAGG No data
1164179652_1164179670 24 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data
1164179652_1164179662 10 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179652_1164179668 22 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179668 19:22807556-22807578 ACGGCCACCGGCAGGGACAGCGG No data
1164179652_1164179661 3 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179652_1164179669 23 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179669 19:22807557-22807579 CGGCCACCGGCAGGGACAGCGGG No data
1164179652_1164179671 25 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179671 19:22807559-22807581 GCCACCGGCAGGGACAGCGGGGG No data
1164179652_1164179657 -10 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179652_1164179665 15 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179665 19:22807549-22807571 GCCCACGACGGCCACCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179652 Original CRISPR GCCCGGGCCACAGAGCCGCG CGG (reversed) Intergenic