ID: 1164179657

View in Genome Browser
Species Human (GRCh38)
Location 19:22807524-22807546
Sequence TGGCCCGGGCTCCAAGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179639_1164179657 24 Left 1164179639 19:22807477-22807499 CCGCTGGTTCCTCCCCACTCGCC No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179650_1164179657 -9 Left 1164179650 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179648_1164179657 -8 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179642_1164179657 11 Left 1164179642 19:22807490-22807512 CCCACTCGCCGCTCTCCAGCCCC No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179645_1164179657 3 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179641_1164179657 12 Left 1164179641 19:22807489-22807511 CCCCACTCGCCGCTCTCCAGCCC No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179647_1164179657 -4 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179638_1164179657 25 Left 1164179638 19:22807476-22807498 CCCGCTGGTTCCTCCCCACTCGC No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179652_1164179657 -10 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179637_1164179657 28 Left 1164179637 19:22807473-22807495 CCGCCCGCTGGTTCCTCCCCACT No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179640_1164179657 15 Left 1164179640 19:22807486-22807508 CCTCCCCACTCGCCGCTCTCCAG No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data
1164179643_1164179657 10 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179657 19:22807524-22807546 TGGCCCGGGCTCCAAGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179657 Original CRISPR TGGCCCGGGCTCCAAGGCGG GGG Intergenic
No off target data available for this crispr