ID: 1164179660

View in Genome Browser
Species Human (GRCh38)
Location 19:22807535-22807557
Sequence GTCGTGGGCGGCCCCCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179660_1164179670 0 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data
1164179660_1164179675 26 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179675 19:22807584-22807606 AATTTCCCAGAGCGGTAAGCCGG No data
1164179660_1164179671 1 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179671 19:22807559-22807581 GCCACCGGCAGGGACAGCGGGGG No data
1164179660_1164179669 -1 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179669 19:22807557-22807579 CGGCCACCGGCAGGGACAGCGGG No data
1164179660_1164179674 18 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179674 19:22807576-22807598 CGGGGGCAAATTTCCCAGAGCGG 0: 2
1: 1
2: 0
3: 6
4: 69
1164179660_1164179668 -2 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179668 19:22807556-22807578 ACGGCCACCGGCAGGGACAGCGG No data
1164179660_1164179665 -9 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179665 19:22807549-22807571 GCCCACGACGGCCACCGGCAGGG No data
1164179660_1164179664 -10 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179664 19:22807548-22807570 CGCCCACGACGGCCACCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179660 Original CRISPR GTCGTGGGCGGCCCCCGCCT TGG (reversed) Intergenic
No off target data available for this crispr