ID: 1164179661

View in Genome Browser
Species Human (GRCh38)
Location 19:22807537-22807559
Sequence AAGGCGGGGGCCGCCCACGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179645_1164179661 16 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179652_1164179661 3 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179641_1164179661 25 Left 1164179641 19:22807489-22807511 CCCCACTCGCCGCTCTCCAGCCC No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179640_1164179661 28 Left 1164179640 19:22807486-22807508 CCTCCCCACTCGCCGCTCTCCAG No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179650_1164179661 4 Left 1164179650 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179642_1164179661 24 Left 1164179642 19:22807490-22807512 CCCACTCGCCGCTCTCCAGCCCC No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179647_1164179661 9 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179643_1164179661 23 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data
1164179648_1164179661 5 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179661 19:22807537-22807559 AAGGCGGGGGCCGCCCACGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179661 Original CRISPR AAGGCGGGGGCCGCCCACGA CGG Intergenic
No off target data available for this crispr