ID: 1164179662

View in Genome Browser
Species Human (GRCh38)
Location 19:22807544-22807566
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179652_1164179662 10 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179659_1164179662 -7 Left 1164179659 19:22807528-22807550 CCGGGCTCCAAGGCGGGGGCCGC No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179650_1164179662 11 Left 1164179650 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179645_1164179662 23 Left 1164179645 19:22807498-22807520 CCGCTCTCCAGCCCCGCGCGGCT No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179643_1164179662 30 Left 1164179643 19:22807491-22807513 CCACTCGCCGCTCTCCAGCCCCG No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179647_1164179662 16 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179658_1164179662 -6 Left 1164179658 19:22807527-22807549 CCCGGGCTCCAAGGCGGGGGCCG No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data
1164179648_1164179662 12 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179662 19:22807544-22807566 GGGCCGCCCACGACGGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179662 Original CRISPR GGGCCGCCCACGACGGCCAC CGG Intergenic