ID: 1164179670

View in Genome Browser
Species Human (GRCh38)
Location 19:22807558-22807580
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179652_1164179670 24 Left 1164179652 19:22807511-22807533 CCGCGCGGCTCTGTGGCCCGGGC No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data
1164179658_1164179670 8 Left 1164179658 19:22807527-22807549 CCCGGGCTCCAAGGCGGGGGCCG No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data
1164179659_1164179670 7 Left 1164179659 19:22807528-22807550 CCGGGCTCCAAGGCGGGGGCCGC No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data
1164179660_1164179670 0 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data
1164179650_1164179670 25 Left 1164179650 19:22807510-22807532 CCCGCGCGGCTCTGTGGCCCGGG No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data
1164179648_1164179670 26 Left 1164179648 19:22807509-22807531 CCCCGCGCGGCTCTGTGGCCCGG No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data
1164179647_1164179670 30 Left 1164179647 19:22807505-22807527 CCAGCCCCGCGCGGCTCTGTGGC No data
Right 1164179670 19:22807558-22807580 GGCCACCGGCAGGGACAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179670 Original CRISPR GGCCACCGGCAGGGACAGCG GGG Intergenic
No off target data available for this crispr