ID: 1164179674

View in Genome Browser
Species Human (GRCh38)
Location 19:22807576-22807598
Sequence CGGGGGCAAATTTCCCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 2, 1: 1, 2: 0, 3: 6, 4: 69}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179659_1164179674 25 Left 1164179659 19:22807528-22807550 CCGGGCTCCAAGGCGGGGGCCGC No data
Right 1164179674 19:22807576-22807598 CGGGGGCAAATTTCCCAGAGCGG 0: 2
1: 1
2: 0
3: 6
4: 69
1164179663_1164179674 6 Left 1164179663 19:22807547-22807569 CCGCCCACGACGGCCACCGGCAG No data
Right 1164179674 19:22807576-22807598 CGGGGGCAAATTTCCCAGAGCGG 0: 2
1: 1
2: 0
3: 6
4: 69
1164179658_1164179674 26 Left 1164179658 19:22807527-22807549 CCCGGGCTCCAAGGCGGGGGCCG No data
Right 1164179674 19:22807576-22807598 CGGGGGCAAATTTCCCAGAGCGG 0: 2
1: 1
2: 0
3: 6
4: 69
1164179666_1164179674 3 Left 1164179666 19:22807550-22807572 CCCACGACGGCCACCGGCAGGGA No data
Right 1164179674 19:22807576-22807598 CGGGGGCAAATTTCCCAGAGCGG 0: 2
1: 1
2: 0
3: 6
4: 69
1164179660_1164179674 18 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179674 19:22807576-22807598 CGGGGGCAAATTTCCCAGAGCGG 0: 2
1: 1
2: 0
3: 6
4: 69
1164179667_1164179674 2 Left 1164179667 19:22807551-22807573 CCACGACGGCCACCGGCAGGGAC No data
Right 1164179674 19:22807576-22807598 CGGGGGCAAATTTCCCAGAGCGG 0: 2
1: 1
2: 0
3: 6
4: 69
1164179673_1164179674 -10 Left 1164179673 19:22807563-22807585 CCGGCAGGGACAGCGGGGGCAAA No data
Right 1164179674 19:22807576-22807598 CGGGGGCAAATTTCCCAGAGCGG 0: 2
1: 1
2: 0
3: 6
4: 69
1164179672_1164179674 -7 Left 1164179672 19:22807560-22807582 CCACCGGCAGGGACAGCGGGGGC No data
Right 1164179674 19:22807576-22807598 CGGGGGCAAATTTCCCAGAGCGG 0: 2
1: 1
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179674 Original CRISPR CGGGGGCAAATTTCCCAGAG CGG Intergenic
900208248 1:1440624-1440646 CGTGGGCAAGTTGCCCAGGGTGG + Exonic
903828215 1:26159941-26159963 TGGGGGCAAATTTCTGGGAGTGG + Intronic
905076305 1:35273829-35273851 AGGGTGCAAATTTCACAAAGTGG + Intronic
906525995 1:46493601-46493623 AGGGAGCACATTTCCCAGATGGG + Intergenic
906796195 1:48698116-48698138 TGGAGGCAGATTTCCCAGAGTGG - Intronic
915758506 1:158286954-158286976 GGGGAGCAACTTGCCCAGAGAGG - Intergenic
916692177 1:167201121-167201143 TGGCGGCAAATCTCACAGAGAGG - Intergenic
917698581 1:177555989-177556011 TGAGGGCAAAGTTTCCAGAGGGG - Intergenic
1063605283 10:7518179-7518201 CGGGGTCCAATTTCCCACATTGG - Intergenic
1063859733 10:10294695-10294717 AGGGGGAACATTTCCCAGCGGGG + Intergenic
1074128485 10:110551650-110551672 TGGGTGCACAATTCCCAGAGTGG - Intergenic
1084775772 11:71374040-71374062 AGAGGGCAAATATCCGAGAGAGG - Intergenic
1085226424 11:74925155-74925177 AGAGGGGAAATGTCCCAGAGAGG + Intronic
1090261864 11:125327105-125327127 TGGGGGTAACCTTCCCAGAGTGG + Intronic
1094428036 12:30336353-30336375 ATGGGGCAATTTTACCAGAGAGG - Intergenic
1094783814 12:33822368-33822390 TGAGGGCAAAGTTTCCAGAGGGG - Intergenic
1102198649 12:111042307-111042329 CCAGGGCAGATTTCCCTGAGTGG + Intronic
1104557406 12:129813503-129813525 GGAGGGCAGATTTACCAGAGTGG - Intronic
1105419032 13:20236476-20236498 TGAGGGCAAGGTTCCCAGAGAGG - Intergenic
1105695209 13:22881709-22881731 AGGAGGCAGATTTCCCTGAGCGG - Intergenic
1111443608 13:88314668-88314690 CTAGGGCAAAGTTCACAGAGGGG + Intergenic
1112180149 13:97070242-97070264 CGGGAGCAAATTGCCCTCAGAGG - Intergenic
1115644988 14:35362775-35362797 CAGGAGCTTATTTCCCAGAGTGG - Intergenic
1121087922 14:91160698-91160720 TGGGGGCACTTTTCCCAGAAGGG - Intronic
1121691127 14:95877530-95877552 CGGGGACCTATTTCCCAGAGCGG - Intergenic
1122770437 14:104095372-104095394 CAGGGGCTAATCTTCCAGAGAGG + Intronic
1126857585 15:52854009-52854031 GGGGGGTAAATTTCCAAGCGGGG - Intergenic
1132554062 16:564989-565011 CGGGCGCACGTTTCACAGAGAGG - Exonic
1133138974 16:3730803-3730825 GGGGGTCAAAATTCCTAGAGGGG + Intronic
1133433870 16:5762545-5762567 CGCGGGGAAATTTCCCAAAGTGG - Intergenic
1134056859 16:11175500-11175522 GGGGGGAAAATTACCCAGTGAGG - Intronic
1142670757 17:1486403-1486425 GGGACGCGAATTTCCCAGAGGGG - Intronic
1143509195 17:7386239-7386261 GGAGTGGAAATTTCCCAGAGGGG + Intronic
1146087880 17:29847149-29847171 GGGGGGAAAAATTCCAAGAGCGG + Intronic
1148330158 17:46809399-46809421 CAGGGGCAGGTTTCCCAGAAAGG + Intronic
1152130926 17:78476000-78476022 TGGGGCAAAATTTCCTAGAGTGG + Intronic
1154438003 18:14361209-14361231 CGGGGGCAGCTGTCCCAGGGTGG + Intergenic
1156030848 18:32710579-32710601 CAGGAGCACATGTCCCAGAGAGG + Intronic
1161257242 19:3316190-3316212 TTGGGGCAAATGTCCCAGAGCGG + Intergenic
1164137693 19:22428501-22428523 CGGGGGCAAATTTCCCAGAGCGG + Intronic
1164160511 19:22623175-22623197 CAGGGGCAAATTTCCCAGAGCGG - Intergenic
1164179674 19:22807576-22807598 CGGGGGCAAATTTCCCAGAGCGG + Intergenic
932178047 2:69620618-69620640 GAGGGTCAAATATCCCAGAGAGG - Intronic
1169817533 20:9673777-9673799 CAAGGGAAAATTTCCCAGAGGGG - Intronic
1171425040 20:25043705-25043727 CGGGGGAACAGCTCCCAGAGTGG + Intronic
1172365987 20:34349855-34349877 CTGAGGCAACTATCCCAGAGTGG - Intergenic
1174064021 20:47851901-47851923 CTGGGGAGAATGTCCCAGAGAGG + Intergenic
1176457675 21:6928260-6928282 CGGGGGCAGCTGTCCCAGGGTGG - Intergenic
1176835847 21:13793344-13793366 CGGGGGCAGCTGTCCCAGGGTGG - Intergenic
1180051259 21:45332006-45332028 CGGGGGCCAACTATCCAGAGAGG + Intergenic
1181646081 22:24232416-24232438 GGAAGGCAAATTTCCCAGTGGGG + Intronic
1181999886 22:26911610-26911632 ATGGGGCAATTTTCCCAGAGTGG - Intergenic
1184759724 22:46537538-46537560 CGGGGGCTGAGTTCCCGGAGCGG + Intergenic
1184932690 22:47692923-47692945 CGGGGGAACAAGTCCCAGAGGGG - Intergenic
1185006297 22:48278780-48278802 CGGTGGCACCTTTTCCAGAGTGG + Intergenic
951305063 3:21049920-21049942 CTGGGTCAAATTTACCAGTGTGG - Intergenic
956682111 3:71790499-71790521 CCAGGACAAATTTCCCAAAGTGG - Intergenic
967359898 3:188618510-188618532 TGGAGGCAAGTTTCACAGAGTGG - Intronic
968659590 4:1793588-1793610 CGGCGGCAAACTTTCCGGAGCGG - Intronic
973643766 4:52929653-52929675 AGGGTGCAAAGTTGCCAGAGAGG + Intronic
980152175 4:129061227-129061249 CGGCAGCAAGTTTCCCAGAATGG + Intronic
1005677057 6:28165297-28165319 CAGGGCTAAATTTCCGAGAGTGG + Intergenic
1005716057 6:28549655-28549677 TGAGGGCAAAATTTCCAGAGAGG + Intergenic
1006947020 6:37791438-37791460 CGGGGGCAGGAATCCCAGAGTGG - Intergenic
1007261642 6:40568210-40568232 CTGGGGTTATTTTCCCAGAGAGG - Intronic
1013071842 6:106736570-106736592 TGGGGGCACAGTTCACAGAGTGG + Intergenic
1014559317 6:122871741-122871763 TGAGGGCAAAGTTTCCAGAGAGG + Intergenic
1017952723 6:159149853-159149875 CTGTGGAATATTTCCCAGAGAGG + Intergenic
1018659052 6:166068246-166068268 TGGGGCCAAATTACCCAAAGTGG + Intergenic
1022238317 7:28484187-28484209 TGGGGGCAAATTACTCAGACAGG - Intronic
1025870039 7:65422810-65422832 CTGGGACAGAGTTCCCAGAGAGG + Intergenic
1031799729 7:126227071-126227093 AGGGGGTAAATTTTCCAGAAAGG - Intergenic
1031921690 7:127606789-127606811 ATGGGGCAAATTTTCCAAAGTGG - Intergenic
1033455059 7:141495572-141495594 CTGGGGCAAAATTTCCAGAAAGG - Intergenic
1039012448 8:33109512-33109534 CCAGGGCAAATGTCCCAGATCGG + Intergenic
1052311662 9:27075013-27075035 CTGGGACAAAGCTCCCAGAGAGG - Intergenic
1062547178 9:137069114-137069136 GGGGGGCCAAGCTCCCAGAGGGG - Intronic
1196294489 X:113982554-113982576 AGCAGGCAAAATTCCCAGAGAGG - Intergenic