ID: 1164179675

View in Genome Browser
Species Human (GRCh38)
Location 19:22807584-22807606
Sequence AATTTCCCAGAGCGGTAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164179666_1164179675 11 Left 1164179666 19:22807550-22807572 CCCACGACGGCCACCGGCAGGGA No data
Right 1164179675 19:22807584-22807606 AATTTCCCAGAGCGGTAAGCCGG No data
1164179663_1164179675 14 Left 1164179663 19:22807547-22807569 CCGCCCACGACGGCCACCGGCAG No data
Right 1164179675 19:22807584-22807606 AATTTCCCAGAGCGGTAAGCCGG No data
1164179672_1164179675 1 Left 1164179672 19:22807560-22807582 CCACCGGCAGGGACAGCGGGGGC No data
Right 1164179675 19:22807584-22807606 AATTTCCCAGAGCGGTAAGCCGG No data
1164179660_1164179675 26 Left 1164179660 19:22807535-22807557 CCAAGGCGGGGGCCGCCCACGAC No data
Right 1164179675 19:22807584-22807606 AATTTCCCAGAGCGGTAAGCCGG No data
1164179667_1164179675 10 Left 1164179667 19:22807551-22807573 CCACGACGGCCACCGGCAGGGAC No data
Right 1164179675 19:22807584-22807606 AATTTCCCAGAGCGGTAAGCCGG No data
1164179673_1164179675 -2 Left 1164179673 19:22807563-22807585 CCGGCAGGGACAGCGGGGGCAAA No data
Right 1164179675 19:22807584-22807606 AATTTCCCAGAGCGGTAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164179675 Original CRISPR AATTTCCCAGAGCGGTAAGC CGG Intergenic
No off target data available for this crispr