ID: 1164187052

View in Genome Browser
Species Human (GRCh38)
Location 19:22879585-22879607
Sequence CTCCTTCCTTTCCCTTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164187052_1164187058 18 Left 1164187052 19:22879585-22879607 CCACTTCAAGGGAAAGGAAGGAG No data
Right 1164187058 19:22879626-22879648 TCTCACTTTTCTTTCTAGGTGGG No data
1164187052_1164187057 17 Left 1164187052 19:22879585-22879607 CCACTTCAAGGGAAAGGAAGGAG No data
Right 1164187057 19:22879625-22879647 CTCTCACTTTTCTTTCTAGGTGG No data
1164187052_1164187056 14 Left 1164187052 19:22879585-22879607 CCACTTCAAGGGAAAGGAAGGAG No data
Right 1164187056 19:22879622-22879644 TTTCTCTCACTTTTCTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164187052 Original CRISPR CTCCTTCCTTTCCCTTGAAG TGG (reversed) Intergenic
No off target data available for this crispr