ID: 1164188472

View in Genome Browser
Species Human (GRCh38)
Location 19:22894028-22894050
Sequence ACCTCCCGCCGCGGACAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164188472_1164188486 23 Left 1164188472 19:22894028-22894050 CCGTCCTGTCCGCGGCGGGAGGT No data
Right 1164188486 19:22894074-22894096 TCCTCCTCTTTCTGCCGCCCGGG No data
1164188472_1164188481 -6 Left 1164188472 19:22894028-22894050 CCGTCCTGTCCGCGGCGGGAGGT No data
Right 1164188481 19:22894045-22894067 GGAGGTGGGCGGGGCAGGCCTGG No data
1164188472_1164188485 22 Left 1164188472 19:22894028-22894050 CCGTCCTGTCCGCGGCGGGAGGT No data
Right 1164188485 19:22894073-22894095 TTCCTCCTCTTTCTGCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164188472 Original CRISPR ACCTCCCGCCGCGGACAGGA CGG (reversed) Intergenic