ID: 1164191788

View in Genome Browser
Species Human (GRCh38)
Location 19:22924652-22924674
Sequence CCCCTCTATAAGTAAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164191788_1164191791 -5 Left 1164191788 19:22924652-22924674 CCTGGGCCTTACTTATAGAGGGG No data
Right 1164191791 19:22924670-22924692 AGGGGATTGAGATATTTTCCAGG No data
1164191788_1164191792 8 Left 1164191788 19:22924652-22924674 CCTGGGCCTTACTTATAGAGGGG No data
Right 1164191792 19:22924683-22924705 ATTTTCCAGGTGAAGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164191788 Original CRISPR CCCCTCTATAAGTAAGGCCC AGG (reversed) Intergenic
No off target data available for this crispr