ID: 1164196820

View in Genome Browser
Species Human (GRCh38)
Location 19:22974877-22974899
Sequence CAACAGAGGGAGACTGTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164196820_1164196827 13 Left 1164196820 19:22974877-22974899 CCCTAGACAGTCTCCCTCTGTTG No data
Right 1164196827 19:22974913-22974935 AAATGCTTTCCTTTGCAATTAGG No data
1164196820_1164196829 25 Left 1164196820 19:22974877-22974899 CCCTAGACAGTCTCCCTCTGTTG No data
Right 1164196829 19:22974925-22974947 TTGCAATTAGGCATGAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164196820 Original CRISPR CAACAGAGGGAGACTGTCTA GGG (reversed) Intergenic
No off target data available for this crispr