ID: 1164197755

View in Genome Browser
Species Human (GRCh38)
Location 19:22986086-22986108
Sequence CTCTGGGTTTGTAGTAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 749
Summary {0: 2, 1: 2, 2: 8, 3: 32, 4: 705}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164197755_1164197762 -2 Left 1164197755 19:22986086-22986108 CCCACTCTACTACAAACCCAGAG 0: 2
1: 2
2: 8
3: 32
4: 705
Right 1164197762 19:22986107-22986129 AGGGCATTCTATCACGCTGGAGG 0: 1
1: 1
2: 3
3: 4
4: 57
1164197755_1164197761 -5 Left 1164197755 19:22986086-22986108 CCCACTCTACTACAAACCCAGAG 0: 2
1: 2
2: 8
3: 32
4: 705
Right 1164197761 19:22986104-22986126 CAGAGGGCATTCTATCACGCTGG 0: 1
1: 2
2: 2
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164197755 Original CRISPR CTCTGGGTTTGTAGTAGAGT GGG (reversed) Intronic
900017764 1:165113-165135 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
900048023 1:523709-523731 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
900070241 1:765569-765591 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
900404321 1:2485844-2485866 CTCTGGGTTTGTGGTAAGCTTGG - Intronic
900679412 1:3908118-3908140 CTCTGGGTTTGTGGGGGTGTTGG + Intergenic
901462569 1:9400411-9400433 CCCTGGGTTTGTCATAGAGCAGG - Intergenic
901693051 1:10986430-10986452 GTGTGTGTTTTTAGTAGAGTCGG + Intergenic
901725801 1:11241147-11241169 CTTTGTATTTTTAGTAGAGTTGG - Intronic
901953416 1:12767019-12767041 CTATAGGTTTGTAGTATATTTGG + Intergenic
902017361 1:13319021-13319043 TTTTGTATTTGTAGTAGAGTTGG - Intronic
903097996 1:20998524-20998546 TTCTGAGTTAGTAGAAGAGTTGG - Intronic
903586552 1:24419909-24419931 CTTTGTGTTTTTAGTAGAGACGG - Intronic
903947002 1:26970356-26970378 TTTTGTATTTGTAGTAGAGTAGG + Intergenic
904175273 1:28623349-28623371 TTTTGTGTTTTTAGTAGAGTTGG - Intronic
904312451 1:29637796-29637818 TTTTGTGTTTTTAGTAGAGTGGG + Intergenic
904404055 1:30274767-30274789 CTCTGATTTTGGAGCAGAGTTGG - Intergenic
904426847 1:30431999-30432021 CTATGGCTTTGTAGTATATTTGG - Intergenic
904516716 1:31061443-31061465 TTCTGTGTTTTCAGTAGAGTCGG - Intronic
905154810 1:35967585-35967607 TTTTGTGTTTGTAGTAGAGATGG + Intronic
905716129 1:40151373-40151395 TTCTGCGTTTTTAGTAGAGATGG - Intergenic
905755317 1:40504480-40504502 TTCTGTATTTGTAGTAGAGATGG + Intergenic
906074791 1:43044075-43044097 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
906176802 1:43781437-43781459 TTTTGTGTTTTTAGTAGAGTGGG - Intronic
907399168 1:54213875-54213897 CTTTGTGTTTTTAGTAGAGATGG - Intronic
909328833 1:74388105-74388127 CTTTGTGTTTCTAGTAGAGATGG - Intronic
909651440 1:77980053-77980075 TTTTGCGTTTGTAGTAGAGACGG + Intronic
913009033 1:114664648-114664670 TTCTGTGTTTTTAGTAGAGATGG + Intronic
913984269 1:143551102-143551124 CTCTGGGTTTGGAGTTAAGCTGG - Intergenic
915062097 1:153194753-153194775 CTCTGAGTTTGGAGTAGACATGG + Intergenic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
918261242 1:182798396-182798418 TTTTGTGTTTGTAGTAGAGACGG + Intronic
919034843 1:192293371-192293393 TTTTGGATTTGTAGTAGAGATGG + Intergenic
919244512 1:194963566-194963588 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
919584251 1:199416407-199416429 CCCTGAGATTGTAGTATAGTAGG + Intergenic
919903865 1:202064131-202064153 TTTTGTGTTTTTAGTAGAGTCGG + Intergenic
920354599 1:205361511-205361533 CTCTTTGTTTTTGGTAGAGTTGG + Intergenic
921168409 1:212524333-212524355 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
921410243 1:214828517-214828539 TTTTGGGTTTGTAGATGAGTGGG + Intergenic
922105605 1:222510981-222511003 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
922265947 1:223983607-223983629 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
922687227 1:227651120-227651142 TTCTGGGTTCATAGTAGAGAGGG + Intronic
922732741 1:227959786-227959808 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
922797388 1:228347167-228347189 CTCTGTGTTTGCGGTAGAGACGG - Intronic
923861850 1:237899528-237899550 CTCTGTATTTTTAGTAGAGACGG + Intergenic
924520929 1:244805544-244805566 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
1063432575 10:6003738-6003760 CTTTGTATTTTTAGTAGAGTCGG + Intergenic
1063488848 10:6444951-6444973 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1063599634 10:7468672-7468694 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1063701287 10:8387647-8387669 TTTTGGATTTGTAGTAGAGACGG + Intergenic
1063967955 10:11361647-11361669 TTCTGGGATTGTGGGAGAGTAGG + Intergenic
1064267388 10:13836166-13836188 TTCTGTATTTGTAGTAGAGACGG + Intronic
1065058726 10:21875049-21875071 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1065843751 10:29727922-29727944 CTCAGGGTTGGTAATAGAGTAGG - Intronic
1066460176 10:35606215-35606237 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1066728572 10:38416339-38416361 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1067003950 10:42643604-42643626 TTCTGTATTTGTAGTAGAGATGG + Intergenic
1067174874 10:43938613-43938635 TTTTGTGTTTTTAGTAGAGTCGG - Intergenic
1069033022 10:63617993-63618015 TTCTGTGTTTTTAGTAGAGTCGG + Intronic
1069402435 10:68063378-68063400 TTCTGGTTTTTTAGTAGAGACGG + Intronic
1069515176 10:69071744-69071766 CTCTGGCTTTGGAGAAGAATGGG - Intergenic
1069653646 10:70070661-70070683 TTCTGTATTTTTAGTAGAGTCGG + Intronic
1070442036 10:76455879-76455901 CTCTGGCTGTGTGGCAGAGTCGG + Intronic
1070837264 10:79457227-79457249 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1070957284 10:80472727-80472749 CTCTGTGTGTGTATTAGAATGGG + Intronic
1071968436 10:90877139-90877161 TTTTGGGTTTTTAGTAGAGATGG - Intronic
1072119147 10:92390847-92390869 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1073180846 10:101582227-101582249 CTCAGGATTTGGGGTAGAGTTGG - Intronic
1073224763 10:101908831-101908853 TTCTGTGTTTTTAGTAGAGAAGG + Intronic
1074010456 10:109473593-109473615 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1075231396 10:120682158-120682180 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1075566286 10:123506864-123506886 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
1075678780 10:124317500-124317522 ATCTGTGTTTGTAGCAGAGAGGG + Intergenic
1075767400 10:124904515-124904537 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1075787290 10:125058619-125058641 CTTTGTATTTTTAGTAGAGTTGG - Intronic
1076076936 10:127540961-127540983 TTCTGGTTTTATACTAGAGTGGG - Intergenic
1076974361 11:160302-160324 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1077001158 11:323138-323160 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1077117986 11:893949-893971 CTTTGTGTTTTTAGTAGAGGCGG - Intronic
1078071645 11:8115990-8116012 CTATAGCTTTGTAGTAGATTTGG - Intronic
1079055287 11:17201033-17201055 TTTTGGGTTTTTAGTAGAGACGG - Intronic
1079102267 11:17549064-17549086 CTCTGTGTTTGTGGGAGAGGTGG + Intronic
1079291642 11:19193527-19193549 CTCTGTATTTTTAGTAGAGACGG + Intronic
1079685941 11:23360241-23360263 TTCTGAGTTTTTAGTAGAGATGG + Intergenic
1080007455 11:27424916-27424938 CTTTGTATTTGTAGTAGAGACGG + Intronic
1081858341 11:46317660-46317682 CTCAGTGTTTGTGGTAGAATTGG + Intronic
1082061720 11:47866787-47866809 TTCTGTATTTGTAGTAGAGACGG - Intergenic
1082646683 11:55735175-55735197 TTGTGTATTTGTAGTAGAGTTGG + Intergenic
1083021126 11:59508458-59508480 GTCTGTGTTTTTAGTAGAGATGG - Intergenic
1083680126 11:64347878-64347900 TTTTGTGTTTTTAGTAGAGTTGG - Intronic
1084742347 11:71147817-71147839 CTCTGTGTTTGAAGCAGAGAGGG - Intronic
1085291207 11:75401052-75401074 TTTTGTGTTTTTAGTAGAGTTGG + Intronic
1085343299 11:75748058-75748080 TTGTGTGTTTTTAGTAGAGTTGG - Intergenic
1085787982 11:79471788-79471810 CTCTGGCCTTGTTGTGGAGTGGG + Intergenic
1086073102 11:82820688-82820710 CTCTGGCTATAGAGTAGAGTAGG - Intergenic
1086446180 11:86873451-86873473 GTGTGTGTTTTTAGTAGAGTCGG + Intronic
1087132954 11:94684569-94684591 CTCTGGGATAGTGGTTGAGTTGG - Intergenic
1087694631 11:101362442-101362464 CTGTTGGTTTGTAGGTGAGTAGG + Intergenic
1088413751 11:109567046-109567068 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1089350464 11:117819059-117819081 TTCTGTGTTTCTAGGAGAGTTGG + Intronic
1090582818 11:128178678-128178700 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
1090758124 11:129813083-129813105 TTTTGTGTTTTTAGTAGAGTCGG - Intergenic
1091784810 12:3236877-3236899 CTCTGGGTTCCTAGTACTGTAGG + Intronic
1092176671 12:6413130-6413152 TTTTGTGTTTGTAGTAGAGACGG - Intergenic
1092191291 12:6522967-6522989 CTTTGGGGTTGAGGTAGAGTTGG - Exonic
1092232099 12:6781796-6781818 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1092260289 12:6949950-6949972 CTTTGTATTTTTAGTAGAGTTGG + Intronic
1092347903 12:7731371-7731393 CTCTTGGTCTGTAAGAGAGTGGG + Intronic
1092815216 12:12306585-12306607 TTTTGTGTTTTTAGTAGAGTCGG - Intergenic
1093037367 12:14345403-14345425 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1093127529 12:15348584-15348606 CACTGTGTTTTTAGTAGAGACGG - Intronic
1093826256 12:23693292-23693314 TTATGGATTTGTAGTAGAGGTGG + Intronic
1094679485 12:32655415-32655437 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1094820862 12:34223128-34223150 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1095970173 12:47896446-47896468 CTCGGGGCTCGGAGTAGAGTGGG + Intronic
1096151260 12:49314501-49314523 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1096423954 12:51485050-51485072 CTGTGTGTTTGGAGCAGAGTGGG + Intronic
1096624007 12:52882161-52882183 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1096987725 12:55772480-55772502 CTCTGGGGTTGAAGAGGAGTGGG - Intronic
1097043170 12:56168542-56168564 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1097112668 12:56673459-56673481 ATTTGTATTTGTAGTAGAGTCGG - Intronic
1098128571 12:67324157-67324179 CTCTGGTTTCAGAGTAGAGTAGG - Intergenic
1098346006 12:69504031-69504053 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1098491546 12:71086880-71086902 TTTTGGATTTTTAGTAGAGTTGG + Intronic
1098580490 12:72094016-72094038 CTCTGGGATTGTGGTTGAATCGG + Intronic
1099108330 12:78523689-78523711 CTGTAGGCTTGTAGTATAGTTGG - Intergenic
1099468055 12:83011003-83011025 TTTTGGGTTTTTAGTAGAGATGG + Intronic
1099796168 12:87402838-87402860 ATGTGGGTGTGTATTAGAGTTGG - Intergenic
1100126540 12:91433672-91433694 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1100508698 12:95246291-95246313 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1101207801 12:102506271-102506293 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1101506899 12:105355338-105355360 TTTTGTGTTTTTAGTAGAGTTGG + Intronic
1102209534 12:111115455-111115477 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1102289748 12:111689545-111689567 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1102302136 12:111778659-111778681 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1102885234 12:116516869-116516891 CTCTGTGTTGGTAGCAGAGCTGG - Intergenic
1103756176 12:123209101-123209123 TTTTGGGTTTTTAGTAGAGATGG + Intronic
1103776624 12:123371158-123371180 GTGTGGGTTTTTAGTAGAGACGG - Intergenic
1104059401 12:125254853-125254875 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG + Intergenic
1106053951 13:26221403-26221425 CTTTGGCTTTGCAGCAGAGTGGG - Intronic
1107114859 13:36735565-36735587 CTTTGTGTTTGTAGTACAGAGGG + Intergenic
1107170157 13:37332018-37332040 TTTTGTGTTTTTAGTAGAGTAGG + Intergenic
1107340470 13:39399921-39399943 CTTTGTGTTTTTAGTAGAGACGG - Intronic
1107517354 13:41143758-41143780 CTTTGGGTTTATAGTCAAGTTGG - Intergenic
1107766365 13:43739375-43739397 CTTTGCGTTTTTAGTAGAGATGG - Intronic
1107903672 13:45043023-45043045 CTCTGGGTTTGGAGGAGGTTGGG - Intergenic
1108764403 13:53609101-53609123 CTCTTGGTTTGTAGAAGTTTTGG + Intergenic
1108886502 13:55191144-55191166 CTCTGCTTTTGTGGTATAGTAGG - Intergenic
1109528487 13:63606955-63606977 CTCTAGGATTGTAGTTGAATGGG - Intergenic
1109569406 13:64166493-64166515 CTCTGGGTTTGTAAATGAGGCGG + Intergenic
1109581645 13:64347040-64347062 TTCTGTGTTTGTAGTAGAGACGG - Intergenic
1110080449 13:71303558-71303580 GTGTGTGTTTGTAGTAGAGATGG - Intergenic
1110815871 13:79859357-79859379 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1112057577 13:95705020-95705042 CTCTGTATTTTTAGTAGAGATGG + Intronic
1112331084 13:98477500-98477522 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1113322461 13:109248551-109248573 CTCTGCGATTGTACAAGAGTAGG + Intergenic
1113340740 13:109422983-109423005 TTTTGCGTTTTTAGTAGAGTCGG + Intergenic
1113449648 13:110398486-110398508 ATTTGTGTTTTTAGTAGAGTCGG - Intronic
1115337166 14:32253525-32253547 TTTTGTGTTTGTAGTAGAGACGG - Intergenic
1115686508 14:35802135-35802157 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG + Intronic
1116871354 14:50071596-50071618 TTCTGTATTTTTAGTAGAGTCGG + Intergenic
1116952375 14:50891413-50891435 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1117364835 14:55015867-55015889 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1118016904 14:61670020-61670042 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1118028153 14:61791676-61791698 TTCTGTATTTGTAGTAGAGATGG - Intronic
1119050942 14:71367775-71367797 TTTTGGGTTTTTAGTAGAGACGG + Intronic
1119073235 14:71608722-71608744 CTCTGTATTTTTAGTAGAGACGG - Intronic
1119385376 14:74254950-74254972 TTTTGTGTTTTTAGTAGAGTCGG + Intronic
1119590238 14:75880456-75880478 CCCTGGGTGAGTAGTAGAGGAGG - Intronic
1119683408 14:76610393-76610415 CTTTGTATTTGTAGTAGAGATGG + Intergenic
1120170078 14:81239366-81239388 TTCTGTGTTTTTAGTAGAGGTGG + Intergenic
1120374083 14:83678114-83678136 CTGTGTGTTTTTAGTAGAGACGG - Intergenic
1120454937 14:84718750-84718772 GTCTGGGGTTGGAGTAGAGAGGG - Intergenic
1121802372 14:96785305-96785327 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
1122296789 14:100710313-100710335 TTTTGGGTTTTTAGTAGAGACGG + Intergenic
1122667616 14:103343988-103344010 CTCTGGCTTTGTAGTAGTCAGGG - Exonic
1122678789 14:103439953-103439975 CTTTGTGTTTTTAGTAGAGACGG + Intronic
1122709475 14:103645141-103645163 TTTTGTATTTGTAGTAGAGTCGG + Intronic
1122713452 14:103678102-103678124 CACTGTGTTTTTAGTAGAGATGG - Intronic
1123925029 15:25100102-25100124 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1125053953 15:35335781-35335803 CTGTGGTCTTGTAGTATAGTTGG + Intronic
1125257093 15:37777634-37777656 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1125406418 15:39356730-39356752 CTCTGGGTTATTGGTATAGTTGG - Intergenic
1125617972 15:41032865-41032887 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1125824765 15:42666983-42667005 TTCTGCGTTTTTAGTAGAGACGG + Intronic
1125909823 15:43426267-43426289 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1126471674 15:49018756-49018778 CTTTGGGTTTGTGGCAGGGTAGG - Intronic
1126619535 15:50623239-50623261 TTTTGTGTTTTTAGTAGAGTCGG - Intronic
1126838740 15:52695093-52695115 TTTTGTGTTTTTAGTAGAGTTGG + Intronic
1127438485 15:58982486-58982508 CTTTGTGTTTTTAGTAGAGACGG + Intronic
1128235442 15:66064195-66064217 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1128505402 15:68267368-68267390 TTCTGTATTTGTAGTAGAGATGG + Intergenic
1129543523 15:76371488-76371510 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1129938338 15:79470420-79470442 CTCTGGATTTGCAGAAGAGGGGG + Exonic
1130005503 15:80093135-80093157 GTGTGTGTTTTTAGTAGAGTCGG + Intronic
1130347257 15:83059373-83059395 TTTTGTGTTTTTAGTAGAGTCGG - Intronic
1131359223 15:91774722-91774744 CTCTGGGTATGAAGTCCAGTGGG + Intergenic
1131573147 15:93559586-93559608 CTCTGGGTTTGCAATAGATAAGG + Intergenic
1132039897 15:98516277-98516299 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1132535867 16:480114-480136 TTTTGGGTTTTTAGTAGAGATGG - Intronic
1132867149 16:2099000-2099022 TTTTGTATTTGTAGTAGAGTCGG + Intronic
1132987275 16:2774057-2774079 CTTTGTGTTTTTAGTAGAGATGG - Intronic
1133297786 16:4763544-4763566 CGCTGGGTTTGTAGTTGCCTAGG - Intronic
1133311894 16:4853730-4853752 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1133355552 16:5134047-5134069 TTTTGTGTTTTTAGTAGAGTTGG - Intergenic
1133436831 16:5786963-5786985 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1133587605 16:7211217-7211239 CTTTGTGTTTTTAGTAGAGACGG - Intronic
1133672908 16:8041470-8041492 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1133811318 16:9163141-9163163 TTCTGTATTTTTAGTAGAGTTGG + Intergenic
1133958187 16:10465565-10465587 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1134110952 16:11515273-11515295 TTCTGGATTTTTAGTAGAGATGG - Intronic
1134162360 16:11901923-11901945 TTTTGTGTTTTTAGTAGAGTTGG - Intronic
1134269250 16:12719217-12719239 TTTTGTGTTTTTAGTAGAGTCGG - Intronic
1134271142 16:12734549-12734571 TTCTGGATTTTTAGTAGAGACGG + Intronic
1134287796 16:12877496-12877518 TTTTGTGTTTTTAGTAGAGTCGG + Intergenic
1134398243 16:13885128-13885150 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1134586140 16:15412750-15412772 TTTTGGATTTTTAGTAGAGTCGG + Intronic
1135803873 16:25524442-25524464 CTTTGTATTTTTAGTAGAGTAGG + Intergenic
1136371658 16:29840519-29840541 CTCTGGGTGTGTGGAAGAGGTGG + Intronic
1136379241 16:29884419-29884441 TTTTGGGTTTTTAGTAGAGACGG - Intronic
1136505796 16:30702402-30702424 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1136521410 16:30798672-30798694 TTCTGCGTTTTTAGTAGAGATGG + Intergenic
1136649216 16:31652004-31652026 CTCTGGACTTCTAGTAGAGACGG - Intergenic
1137622901 16:49888154-49888176 TTTTGTGTTTTTAGTAGAGTGGG - Intergenic
1138566518 16:57837295-57837317 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1138936186 16:61726856-61726878 CTCTGGGTTTGTGGCACAGCAGG + Intronic
1139265040 16:65630647-65630669 TTTTGTGTTTTTAGTAGAGTCGG + Intergenic
1139433669 16:66924492-66924514 ATTTGTGTTTTTAGTAGAGTTGG - Intronic
1140640071 16:76961116-76961138 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1141086345 16:81098163-81098185 CTTTGGATTTGTAGTAGAGACGG - Intergenic
1141106631 16:81239185-81239207 CTGTGTGTTTTTAGTAGAGACGG + Intronic
1141750752 16:85956337-85956359 CCCTGTGGTTGTAGTGGAGTGGG - Intergenic
1141861821 16:86722320-86722342 TTCTGGATTTTTAGTAGAGATGG - Intergenic
1142019437 16:87771888-87771910 TTTTGTGTTTGTAGTAGAGACGG - Intergenic
1142117579 16:88367924-88367946 CTCTGTGTTTGCCGTAGAGCTGG - Intergenic
1142298795 16:89244248-89244270 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1142445899 16:90137342-90137364 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1142461610 17:98119-98141 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1142548755 17:724456-724478 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
1142654358 17:1381342-1381364 TTTTGTGTTTTTAGTAGAGTCGG - Intronic
1142847999 17:2691389-2691411 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1143024302 17:3932312-3932334 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1143084821 17:4407745-4407767 CTTTGTATTTTTAGTAGAGTCGG - Intergenic
1144087229 17:11821752-11821774 CCCTGGGTTTGGAGTAGACATGG + Intronic
1144137253 17:12308494-12308516 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1144172647 17:12673836-12673858 CTCTGAGTTAGTTGTACAGTAGG - Intronic
1144465584 17:15494187-15494209 CTCTGTATTTTTAGTAGAGATGG - Intronic
1144809878 17:17992102-17992124 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1144997043 17:19277228-19277250 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1145044987 17:19606645-19606667 TTCTGTATTTTTAGTAGAGTTGG + Intergenic
1147405365 17:40207851-40207873 TTCTGGATTTTTAGTAGAGACGG + Intergenic
1147465299 17:40606295-40606317 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1147802430 17:43102241-43102263 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1148018248 17:44537586-44537608 CTTTGTATTTTTAGTAGAGTCGG + Intergenic
1148432838 17:47656373-47656395 TTTTGGGTTTTTAGTAGAGATGG - Intronic
1149935087 17:60797064-60797086 CTCTGTATTTTTAGTAGAGATGG + Intronic
1150313003 17:64144983-64145005 CTATGGGTTTGTAGTTGAATGGG - Intergenic
1151129914 17:71886097-71886119 CCCTGGGTTGGGGGTAGAGTGGG + Intergenic
1151374820 17:73680484-73680506 CTGTTGGTTTCTAATAGAGTTGG + Intergenic
1151522060 17:74637290-74637312 TTTTGGATTTTTAGTAGAGTCGG + Intergenic
1151907554 17:77058645-77058667 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1151930116 17:77227057-77227079 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1152715163 17:81896111-81896133 TTTTGGATTTTTAGTAGAGTCGG - Intronic
1153543429 18:6181498-6181520 CTTTGTATTTTTAGTAGAGTGGG + Intronic
1153822000 18:8839989-8840011 CTCTGTCTTTGAAGTGGAGTGGG - Intergenic
1154084456 18:11289630-11289652 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1154938953 18:21091797-21091819 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1155295288 18:24379347-24379369 TTTTGTGTTTTTAGTAGAGTTGG - Intronic
1155772550 18:29720331-29720353 CTCTGGTTTTGTAGATGAGAGGG - Intergenic
1155855008 18:30822184-30822206 CTCTGGCTTTGGAATAAAGTTGG - Intergenic
1155937021 18:31764712-31764734 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1157229284 18:45898952-45898974 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1157233147 18:45938288-45938310 TTTTGGGTTTGTAGTAGAGACGG - Intronic
1157343501 18:46802381-46802403 TTCTGTGTTTTTAGTAGAGAAGG - Intergenic
1157350891 18:46884481-46884503 TTTTGTGTTTTTAGTAGAGTCGG + Intronic
1158089319 18:53692318-53692340 TTCTGGATTTTTAGTAGAGATGG - Intergenic
1159622526 18:70655125-70655147 TTCTGTATTTTTAGTAGAGTCGG + Intergenic
1159774349 18:72585927-72585949 CTCTGATTTTGGAGTAAAGTTGG - Intronic
1159884791 18:73893654-73893676 CTCTGGCTTTTTAGAAGTGTGGG + Intergenic
1160193399 18:76733607-76733629 TTTTGTGTTTTTAGTAGAGTCGG - Intergenic
1160651310 19:230486-230508 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1160885700 19:1346498-1346520 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1161374969 19:3934749-3934771 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1161568239 19:5015420-5015442 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1161645194 19:5448993-5449015 TTTTGTGTTTTTAGTAGAGTGGG + Intergenic
1161910305 19:7188373-7188395 TTCTGTATTTTTAGTAGAGTCGG - Intronic
1162122551 19:8480492-8480514 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1162601832 19:11675414-11675436 TTTTGGATTTTTAGTAGAGTCGG - Intergenic
1162888554 19:13715175-13715197 TTCTGTATTTTTAGTAGAGTTGG - Intergenic
1163824798 19:19516955-19516977 CTTTGTGTTTTTAGTAGAGACGG + Intronic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164014690 19:21242954-21242976 CTCTGGGTTTGTAGTGGAGTTGG - Intronic
1164031276 19:21408001-21408023 CTCTGGGTTTGTAGTGGAGTGGG + Intronic
1164045127 19:21531303-21531325 CTATGGATTTGTAATAGAGAGGG - Intronic
1164102938 19:22075081-22075103 CTCTGGGTTTGTGATGGAGAGGG + Intronic
1164113359 19:22191790-22191812 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164197755 19:22986086-22986108 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164215071 19:23137758-23137780 CTCTGGGCTTATAGTGGAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164373113 19:27658604-27658626 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1164940042 19:32245068-32245090 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1165477033 19:36036768-36036790 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1165541390 19:36494848-36494870 TTTTGGGTTTCTAGTAGAGACGG + Intergenic
1165698952 19:37922563-37922585 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1166188832 19:41161643-41161665 TTTTGTGTTTTTAGTAGAGTTGG - Intergenic
1166840807 19:45695815-45695837 CTCTGTGCGTGGAGTAGAGTGGG - Intronic
1166973973 19:46592590-46592612 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1167055091 19:47105428-47105450 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1167068164 19:47202739-47202761 CTCTGAATTTTTAGTAGAGACGG - Intronic
1167164803 19:47791189-47791211 TTTTGTGTTTTTAGTAGAGTCGG - Intergenic
1167335271 19:48881553-48881575 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1167933389 19:52886763-52886785 CTTTGTGTTTTTAGTAGAGATGG - Intronic
1167936620 19:52913953-52913975 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1168030673 19:53677292-53677314 CTCTTGGGTTGAGGTAGAGTTGG + Intergenic
1168091738 19:54090079-54090101 CTTTGTATTTTTAGTAGAGTCGG + Intergenic
1168141931 19:54393886-54393908 CTGTGTGTTTTTAGTAGAGACGG - Intergenic
1168223593 19:54978674-54978696 TTTTGTGTTTTTAGTAGAGTTGG - Intronic
1168592838 19:57651473-57651495 GTCTGGGCTTGTTGTAGACTGGG - Intergenic
925573558 2:5336708-5336730 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
926052097 2:9751849-9751871 CTATGGGTTTCTAGTGGATTGGG + Intergenic
926153641 2:10438508-10438530 CTCTGGGGATGGAGTAGTGTTGG - Intergenic
926182222 2:10655037-10655059 TTTTGTGTTTTTAGTAGAGTCGG - Intronic
926668037 2:15546556-15546578 TTTTGTGTTTTTAGTAGAGTCGG - Intronic
926710855 2:15879155-15879177 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
926930026 2:18027856-18027878 ATATGTCTTTGTAGTAGAGTTGG + Intronic
927579934 2:24233589-24233611 GTCTGAGTAAGTAGTAGAGTTGG - Intronic
927763652 2:25783881-25783903 TTTTGTATTTGTAGTAGAGTCGG - Intronic
927775884 2:25902817-25902839 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
927796713 2:26055693-26055715 TTTTGTGTTTGTAGTAGAGATGG + Intronic
928140949 2:28728456-28728478 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
928851610 2:35754163-35754185 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
929194463 2:39171066-39171088 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
929205233 2:39284329-39284351 TTCTGTATTTGTAGTAGAGATGG + Intronic
929305975 2:40362063-40362085 CTCTGTATTTTTAGTAGAGATGG + Intronic
929356875 2:41036053-41036075 TTTTGTGTTTTTAGTAGAGTTGG - Intergenic
931262095 2:60629329-60629351 CTCTAGGTTTCTAGAAGAGAAGG + Intergenic
931519008 2:63074654-63074676 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
932183917 2:69675092-69675114 TTCTGTATTTGTAGTAGAGACGG + Intronic
932336113 2:70932345-70932367 CTCTGGGCCTGAGGTAGAGTTGG + Intronic
932500794 2:72181035-72181057 TTCTGGATTTTTAGTAGAGATGG - Intronic
932915185 2:75850244-75850266 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
933149785 2:78900811-78900833 CTCTGGGTTTATATTATATTTGG - Intergenic
933749896 2:85596549-85596571 CTTGGGGTTGGTAGTAGATTGGG + Exonic
933984974 2:87583396-87583418 CTGTGGATGTGTAGGAGAGTCGG + Intergenic
935051240 2:99526770-99526792 TTTTGTGTTTGTAGTAGAGACGG + Intergenic
935073435 2:99716318-99716340 CTCTGGGATAGTAGCAGAATGGG + Intronic
935158873 2:100511632-100511654 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
935449481 2:103192193-103192215 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
935796157 2:106643310-106643332 TTCTGAGTTTTTAGTAGAGACGG + Intergenic
936107990 2:109641974-109641996 TTTTGGGTTTTTAGTAGAGACGG + Intergenic
936133020 2:109863539-109863561 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
936211677 2:110507946-110507968 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
936308873 2:111367415-111367437 CTGTGGATGTGTAGGAGAGTCGG - Intergenic
936420816 2:112362523-112362545 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
936577114 2:113666404-113666426 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
937416079 2:121715620-121715642 CTCTGTATTTTTAGTAGAGACGG - Intergenic
937892464 2:126948958-126948980 CTCTGGGTTGGTAGAAGATGTGG + Intergenic
937983150 2:127626606-127626628 TTCTGTGTTTTTAGTAGAGGGGG - Intronic
938035225 2:128029137-128029159 CGATGGGTTTGAAGTTGAGTAGG - Intergenic
938469655 2:131546765-131546787 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
938861611 2:135375380-135375402 CTTTGTGTTTTTAGTAGAGATGG - Intronic
938950076 2:136247198-136247220 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
938965803 2:136387517-136387539 CTCTAGGTTTGTAAGAGACTAGG + Intergenic
939731238 2:145787108-145787130 CTGTAGGCTTGTAGTATAGTTGG - Intergenic
940035569 2:149309320-149309342 CTCTCTGTTTGTAGTCAAGTTGG - Intergenic
940104567 2:150083793-150083815 TTTTGGGTTTTTAGTAGAGACGG - Intergenic
940674651 2:156713903-156713925 TTTTGTATTTGTAGTAGAGTCGG + Intergenic
940844913 2:158629902-158629924 TTTTGGATTTTTAGTAGAGTCGG + Intronic
940917784 2:159276230-159276252 TTCTGTGTTTTTAGTAGAGACGG + Intronic
941154033 2:161953435-161953457 CTTTGTGTTTTTAGTAGAGATGG - Intronic
941209156 2:162614187-162614209 TTATGGTTTTGTAGTAGATTAGG - Intronic
941223592 2:162816085-162816107 TTTTGGGTTTTTAGTAGAGATGG - Intronic
941257613 2:163252968-163252990 CTCTGTGTTTCTATGAGAGTAGG - Intergenic
941284226 2:163589038-163589060 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
941515116 2:166463883-166463905 TTTTGTGTTTGTAGTAGAGATGG - Intronic
941826442 2:169902777-169902799 CTTTGTGTTTTTAGTAGAGGTGG + Intronic
942175388 2:173328897-173328919 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
942581693 2:177425789-177425811 CTGTAGGCTTGTAGTATAGTTGG + Intronic
942723418 2:178980275-178980297 TTTTGGATTTGTAGTAGAGATGG - Intronic
943198566 2:184788963-184788985 CTGTGGGTTTGTCATAGAGATGG + Intronic
943601497 2:189926456-189926478 TTTTGGGTTTTTAGTAGAGACGG + Intronic
944510568 2:200460982-200461004 TTTTGGGTTTTTAGTAGAGATGG + Intronic
944643316 2:201751021-201751043 TTCTGTGTTTTTAGTAGAGATGG + Intronic
944646122 2:201782416-201782438 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
944895784 2:204162899-204162921 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
945617853 2:212095758-212095780 TTCTGTGTTTTTAGTAGAGACGG - Intronic
946334600 2:219028677-219028699 CTCTGGGCTGGCAGTAGGGTGGG - Intronic
946531109 2:220571237-220571259 CTCTGTGTGTGTAGGAGAGGGGG - Intergenic
947660565 2:231863392-231863414 TTTTGCGTTTGTAGTAGAGATGG + Intergenic
948940493 2:241193238-241193260 TTTTGTGTTTGTAGTAGAGACGG + Intronic
949037870 2:241826466-241826488 CTTTGTATTTTTAGTAGAGTCGG - Intergenic
1169182836 20:3585142-3585164 CTGTGGGTTTCTAGAACAGTTGG + Intronic
1169351690 20:4873263-4873285 GTCTGGGTTTTTATTAGAATTGG - Intronic
1169890875 20:10450922-10450944 TTTTGGGTTTTTAGTAGAGACGG + Intronic
1171241432 20:23570177-23570199 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1171527010 20:25821654-25821676 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1171549817 20:26034231-26034253 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1172258784 20:33543182-33543204 TTTTGTGTTTGTAGTAGAGCAGG + Intronic
1172577995 20:36024163-36024185 TTTTGGGTTTTTAGTAGAGATGG - Intronic
1172716407 20:36967549-36967571 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1173649362 20:44653161-44653183 TTTTGGATTTGTAGTAGAGACGG + Intergenic
1173703470 20:45093471-45093493 CTCTGGGCTTGGTGCAGAGTAGG - Exonic
1174026733 20:47582963-47582985 TTCTGTATTTTTAGTAGAGTTGG + Intronic
1174380113 20:50150864-50150886 TTCTGTATTTTTAGTAGAGTCGG + Intronic
1174454388 20:50639069-50639091 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1174472409 20:50770678-50770700 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1174589972 20:51637160-51637182 CTCTGGGATAGTAGTAGAAATGG - Intronic
1174596159 20:51685386-51685408 TTTTGGATTTTTAGTAGAGTTGG - Intronic
1174793288 20:53499575-53499597 CTTTGTATTTTTAGTAGAGTTGG - Intergenic
1175120490 20:56712660-56712682 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1176219142 20:63961798-63961820 CTCTGGGTTCGTGGAAGAGGAGG + Intronic
1177298916 21:19214452-19214474 TTTTGCGTTTTTAGTAGAGTTGG - Intergenic
1177345409 21:19862076-19862098 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1177423106 21:20887443-20887465 CTGTGGCTTTATAGTATAGTTGG + Intergenic
1177972533 21:27808361-27808383 TTCTGCATTTGTAGTAGAGACGG - Intergenic
1178291082 21:31369052-31369074 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1178317417 21:31578262-31578284 CTTTGCGTTTTTAGTAGAGATGG - Intergenic
1178777944 21:35570052-35570074 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1179666263 21:42914696-42914718 TTTTGGGTTTTTAGTAGAGATGG - Intergenic
1179682585 21:43034659-43034681 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1180190185 21:46159176-46159198 CTCTGGGTCTCTAGAAGAATGGG - Intergenic
1180302622 22:11049701-11049723 TTTTGGGTTTTTAGTAGAGGCGG - Intergenic
1180685589 22:17664153-17664175 TTTTGTGTTTTTAGTAGAGTTGG + Intronic
1180822227 22:18838436-18838458 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1181190745 22:21137610-21137632 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1181208460 22:21272897-21272919 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1181335889 22:22128107-22128129 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
1181419891 22:22790421-22790443 CTCTGGGTCTGAGGGAGAGTTGG + Intronic
1181564295 22:23724946-23724968 TTCTGTGTTTTTAGTAGAGCTGG - Intergenic
1181674589 22:24443512-24443534 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1181750211 22:24983946-24983968 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1181891262 22:26065523-26065545 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
1181969515 22:26679695-26679717 TTCTGTATTTTTAGTAGAGTCGG + Intergenic
1182049693 22:27303232-27303254 GTCTGGGTTTGGGGTTGAGTTGG - Intergenic
1182375349 22:29843251-29843273 CTTTGGATTTTTAGTAGAGACGG - Intergenic
1182506762 22:30788881-30788903 TTTTGTGTTTTTAGTAGAGTTGG + Intronic
1182938230 22:34247441-34247463 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1183253692 22:36747168-36747190 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
1183342310 22:37288239-37288261 CTCTGTATTTTTAGTAGAGATGG - Intronic
1183557081 22:38537382-38537404 CTCTGTATTTTTAGTAGAGACGG + Intronic
1183563870 22:38598809-38598831 CACTCGGTTTGCAGTAGAGTTGG + Intronic
1184346454 22:43916569-43916591 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1184532659 22:45066293-45066315 CTTTGTATTTGTAGTAGAGGCGG + Intergenic
1185423124 22:50746260-50746282 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1203218473 22_KI270731v1_random:22515-22537 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1203272361 22_KI270734v1_random:64321-64343 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
949544303 3:5059351-5059373 TTCTGTGTTTTTAGTAGAGGTGG + Intergenic
949645747 3:6091761-6091783 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
950122429 3:10490569-10490591 TTTTGTGTTTTTAGTAGAGTTGG + Intronic
950297176 3:11842215-11842237 TTTTGTGTTTTTAGTAGAGTGGG - Intronic
950716147 3:14849011-14849033 TTCTGTGTTTGGAGTAGAGGAGG + Intronic
951151491 3:19295701-19295723 CTGTGGGTTTGTACTTCAGTGGG + Intronic
951185844 3:19712193-19712215 CTAAGGTTTTGAAGTAGAGTTGG - Intergenic
951409237 3:22342101-22342123 TTCTGTGTTTTTAGTAGAGACGG - Intronic
951494702 3:23313553-23313575 TTTTGTGTTTTTAGTAGAGTCGG + Intronic
951880320 3:27474935-27474957 TTTTGTGTTTGTAGTAGAGATGG - Intronic
952222688 3:31340809-31340831 CTTTGGATTTTTAGTAGAGATGG - Intergenic
952714548 3:36466297-36466319 CTATGGCTTTATAGTATAGTTGG + Intronic
954040794 3:47885898-47885920 CTTTGCATTTTTAGTAGAGTTGG + Intronic
954189735 3:48949287-48949309 TTTTGTGTTTTTAGTAGAGTCGG + Intronic
954245597 3:49329005-49329027 TTTTGTGTTTGTAGTAGAGACGG - Intronic
954594345 3:51812573-51812595 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
955119657 3:56044812-56044834 CTCTGGGTTTGTATTTGATTTGG - Intronic
955181106 3:56670763-56670785 TTTTGCGTTTTTAGTAGAGTTGG - Intronic
955285263 3:57634260-57634282 TTCTGTGTTTTTAGTAGAGACGG - Intronic
955945750 3:64191933-64191955 CTCTGGGTCTGGAGCAGGGTGGG - Intronic
956627223 3:71278608-71278630 GTTTGTGTTTGTAGTAGAGATGG - Intronic
957210222 3:77249020-77249042 TTCTGTGTTTTTAGTAGAGAAGG + Intronic
957402610 3:79735696-79735718 TTCTGGATTTTTAGTAGAGACGG - Intronic
957510712 3:81184488-81184510 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
958016796 3:87946795-87946817 TTTTGTGTTTTTAGTAGAGTCGG + Intergenic
958441769 3:94164253-94164275 TTTTGTGTTTGTAGTAGAGACGG - Intergenic
959391452 3:105780021-105780043 CTTTGGATTTTTAGTAGAGACGG + Intronic
959899498 3:111644079-111644101 CTATGGCTTTATAGTATAGTTGG - Intronic
960599527 3:119442168-119442190 CTTTGGATTTTTAGTAGAGTCGG - Intronic
960630161 3:119722284-119722306 CTCTGTATTTTTAGTAGAGACGG - Intronic
960753729 3:120984318-120984340 CTCTGGGTTTGGAGGAGAAGTGG - Intronic
961252294 3:125517803-125517825 TTTTGTGTTTTTAGTAGAGTTGG - Intronic
962284794 3:134076633-134076655 CACTGGGGTTGTAGTACTGTTGG + Intronic
963333445 3:143943398-143943420 CTCTGCATTTTTAGTAGAGACGG - Intergenic
963493431 3:146030002-146030024 CTGTAGCTTTGTAGTATAGTTGG + Intergenic
963704597 3:148670242-148670264 CCCTGTGTTTTTAGTAGAGATGG + Intergenic
964048181 3:152357150-152357172 CTCTGGGCTTGTACTACACTGGG - Intronic
964148224 3:153492095-153492117 TTTTGTGTTTGTAGTAGAGATGG - Intronic
967638215 3:191830610-191830632 TTTTGGATTTGTAGTAGAGACGG - Intergenic
968280425 3:197472844-197472866 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
968366521 3:198189493-198189515 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
968440125 4:619215-619237 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
968694466 4:2016216-2016238 CTCTGGGCTTTCTGTAGAGTAGG + Intronic
969000379 4:3976013-3976035 TTTTGTGTTTTTAGTAGAGTCGG + Intergenic
969813536 4:9668835-9668857 TTTTGTGTTTTTAGTAGAGTCGG - Intergenic
970437955 4:16053922-16053944 CTTTGTATTTTTAGTAGAGTAGG - Intronic
970667788 4:18358007-18358029 CTCTGGGATTGTAGTCAAGTGGG + Intergenic
970734621 4:19151524-19151546 CTCTGGGTTTTAAGTGGGGTGGG + Intergenic
971401540 4:26280222-26280244 TTCTGTATTTTTAGTAGAGTTGG - Intronic
971956602 4:33428086-33428108 CTCTGACTTTGTAGCAGAGCAGG + Intergenic
971999310 4:34009518-34009540 CTTTGTATTTTTAGTAGAGTCGG + Intergenic
972561201 4:40230506-40230528 GTCTGTGTTTTTAGTAGAGATGG + Intronic
972774229 4:42226700-42226722 TTTTGTGTTTGTAGTAGAGACGG + Intergenic
973077171 4:45943595-45943617 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
973079978 4:45979116-45979138 TTTTGGATTTTTAGTAGAGTCGG - Intergenic
974388953 4:61239597-61239619 CTCTGTGTTTGTATTTAAGTGGG - Intronic
976323192 4:83739423-83739445 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
977345826 4:95814626-95814648 TTCTGGGTTTGGAGTAGCCTGGG + Intergenic
977880418 4:102198136-102198158 TTTTGGGTTTTTAGTAGAGATGG + Intergenic
977943196 4:102880112-102880134 TTCTGTATTTTTAGTAGAGTTGG + Intronic
978051963 4:104212154-104212176 CTGTGGGTATGTAGTATAGTGGG - Intergenic
979333405 4:119441377-119441399 TTTTGTATTTGTAGTAGAGTTGG - Intergenic
980318138 4:131232822-131232844 CTCTGGGCTAGTAGTATACTTGG + Intergenic
980971456 4:139571128-139571150 TTCTGTATTTTTAGTAGAGTCGG - Intronic
981683280 4:147424534-147424556 CTCTGGGTTTGTTATATAGAAGG + Intergenic
982161019 4:152569486-152569508 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
982569482 4:157030503-157030525 CTGTAGCTTTGTAGTATAGTTGG - Intergenic
982622318 4:157723871-157723893 CTCTGGGTTTGTGATGGAGGGGG - Intergenic
982673583 4:158350143-158350165 CTCTATTATTGTAGTAGAGTAGG + Intronic
983212313 4:164971419-164971441 TTCTGTGTTTTTAGTAGAGACGG - Intronic
983214665 4:164991966-164991988 TTTTGTATTTGTAGTAGAGTCGG - Intergenic
983451211 4:167913632-167913654 CTTTGTATTTTTAGTAGAGTCGG - Intergenic
984528762 4:180889706-180889728 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
984798557 4:183690030-183690052 TTTTGGGTTTTTAGTAGAGATGG - Intronic
985056007 4:186036107-186036129 TTTTGTGTTTTTAGTAGAGTGGG - Intergenic
985276103 4:188239504-188239526 CTCTGTATTTTTAGTAGAGATGG + Intergenic
987348505 5:16999845-16999867 TTCTGTATTTGTAGTAGAGATGG - Intergenic
987350497 5:17017730-17017752 CTCTGTATTTTTAGTAGAGATGG + Intergenic
987943510 5:24573527-24573549 TTCTGTATTTTTAGTAGAGTCGG - Intronic
989282740 5:39664569-39664591 TTTTGGGTTTTTAGTAGAGACGG - Intergenic
989507970 5:42249368-42249390 CTCTGTTTCTGTAGTAGACTTGG + Intergenic
989645578 5:43628755-43628777 CTTTATGTTTTTAGTAGAGTCGG + Intronic
990402358 5:55451731-55451753 TTCTGTATTTGTAGTAGAGACGG + Intronic
990598149 5:57331566-57331588 CTTTGGATTTTTAGTAGAGATGG - Intergenic
992004332 5:72462719-72462741 CTTTGTGTTTTTAGTAGAGACGG + Intronic
992012689 5:72544987-72545009 TTTTGGGTTTTTAGTAGAGATGG + Intergenic
992805476 5:80332864-80332886 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
993178303 5:84517115-84517137 TTCTGTATTTGTAGTAGAGATGG - Intergenic
994742957 5:103644005-103644027 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
994956924 5:106544834-106544856 CTCTGGGGTTGTAGTTGAATGGG + Intergenic
995828172 5:116324897-116324919 TTTTGGATTTGTAGTAGAGATGG + Intronic
995829190 5:116334733-116334755 CTCTGGGTTGGTTGTTGGGTGGG - Intronic
996624952 5:125559599-125559621 CTCTGAGTCTGTAGTAGATCTGG - Intergenic
996711306 5:126546075-126546097 TTCTGTATTTTTAGTAGAGTTGG - Intronic
997536222 5:134624236-134624258 TTCTGTATTTTTAGTAGAGTTGG - Intronic
997886283 5:137633106-137633128 TTTTGTATTTGTAGTAGAGTTGG - Intronic
998245802 5:140503735-140503757 CTTTGTGTTTTTAGTAGAGACGG + Intronic
998861791 5:146451491-146451513 TTCTGTATTTTTAGTAGAGTGGG + Intronic
998962673 5:147505403-147505425 CTCTGTATTTTTAGTAGAGACGG + Intronic
1001909579 5:175504402-175504424 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1002042722 5:176526531-176526553 TTCTGTGTTTTTAGTAGAGAAGG + Intergenic
1002119994 5:176995669-176995691 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1002725744 5:181294703-181294725 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1004589557 6:17036195-17036217 CACTGGGTGTGTAGTAGAATGGG - Intergenic
1004791565 6:19032636-19032658 CTCTGGGCCTGTAGTAGGGGAGG + Intergenic
1005042028 6:21608491-21608513 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
1005815721 6:29550754-29550776 CTCTGGATTTGAAATGGAGTTGG - Intergenic
1006098621 6:31671750-31671772 CTCTGGGTTAGAAGTAAATTAGG + Intronic
1006597273 6:35202617-35202639 CTCTGTGTTAGTAGAAGAGTGGG - Intergenic
1006660929 6:35643633-35643655 CACTGGGTTTGTTGTAGAGGTGG - Intronic
1007562743 6:42824063-42824085 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1007603871 6:43102252-43102274 TTTTGGGTTTTTAGTAGAGATGG - Intronic
1008443084 6:51555324-51555346 TTCTGTATTTGTAGTAGAGGTGG - Intergenic
1008639135 6:53443533-53443555 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1010222927 6:73463201-73463223 CTTTGTATTTTTAGTAGAGTCGG + Intronic
1010349785 6:74859764-74859786 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1010660656 6:78566995-78567017 CTCTGGGACTGTGGTTGAGTGGG - Intergenic
1010832816 6:80552072-80552094 GCCTGGGTGTGTAGTAGGGTAGG + Intergenic
1011729813 6:90249599-90249621 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1012352508 6:98270000-98270022 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1012768006 6:103394321-103394343 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1012889540 6:104882919-104882941 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1013011615 6:106125730-106125752 TTCTGGATTTTTAGTAGAGATGG - Intergenic
1013219446 6:108065027-108065049 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1013296469 6:108762097-108762119 CTTTGCATTTGTAGTAGAGATGG - Intergenic
1014046976 6:116900423-116900445 TTTTGTGTTTTTAGTAGAGTCGG + Intronic
1014451133 6:121583242-121583264 TTTTGGGTTTTTAGTAGAGACGG + Intergenic
1014552099 6:122800919-122800941 TTTTGTGTTTGTAGTAGAGATGG + Intronic
1015319766 6:131859554-131859576 TTTTGTGTTTTTAGTAGAGTCGG + Intronic
1016198715 6:141380069-141380091 CTCTGGGTTTGTCCTGGTGTTGG - Intergenic
1016273261 6:142315658-142315680 TTTTGGATTTTTAGTAGAGTCGG - Intronic
1017398455 6:154030717-154030739 CTCTGTATTTTTAGTAGAGATGG - Intronic
1017904619 6:158749049-158749071 CTCTGTATTTTTAGTAGAGACGG - Intronic
1019366258 7:634808-634830 TTTTGTGTTTTTAGTAGAGTCGG + Intronic
1019534682 7:1522853-1522875 CTTTGCATTTTTAGTAGAGTCGG + Intergenic
1020459874 7:8417336-8417358 TTTTGTGTTTTTAGTAGAGTCGG + Intergenic
1020744228 7:12061351-12061373 CTATAGCTTTGTAGTACAGTTGG - Intergenic
1020806044 7:12791421-12791443 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1021314111 7:19124908-19124930 TTCTGTATTTTTAGTAGAGTCGG - Intergenic
1021568257 7:22036367-22036389 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1022357850 7:29632502-29632524 TTTTGTGTTTTTAGTAGAGTTGG - Intergenic
1022368117 7:29745156-29745178 TTTTGTGTTTTTAGTAGAGTTGG - Intergenic
1023066783 7:36385982-36386004 TTTTGTGTTTTTAGTAGAGTTGG - Intronic
1023490348 7:40732917-40732939 CTATGTATTTTTAGTAGAGTTGG - Intronic
1023495656 7:40793181-40793203 CTCTGGGTTTGCAGAAGAGGTGG + Intronic
1024836375 7:53524292-53524314 TTTTGTGTTTGTAGTAGAGACGG + Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026039413 7:66854932-66854954 TTTTGCATTTGTAGTAGAGTTGG + Intergenic
1026250664 7:68667389-68667411 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
1027180088 7:75932845-75932867 CTTTGTATTTGTAGTAGAGATGG - Intronic
1027224323 7:76234487-76234509 CTCTGGGGTGGGAATAGAGTAGG + Intronic
1027246632 7:76372023-76372045 TTTTGGGTTTTTAGTAGAGATGG - Intergenic
1027250225 7:76394014-76394036 CTCTGGGGTTGCAGCTGAGTGGG - Intronic
1027255800 7:76430049-76430071 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1027394552 7:77741155-77741177 TTTTGTGTTTGTAGTAGAGATGG + Intronic
1028339851 7:89705174-89705196 CACTGGGGTTGTAGAAGAGAAGG - Intergenic
1028438740 7:90834565-90834587 ATTTGGGTTTTTAGTAGACTGGG + Intronic
1029185969 7:98738922-98738944 TTCTGTATTTGTAGTAGAGGTGG + Intergenic
1029387325 7:100252032-100252054 TTTTGTGTTTTTAGTAGAGTTGG - Intronic
1029562546 7:101312705-101312727 TTTTGTGTTTTTAGTAGAGTCGG + Intergenic
1029583035 7:101449951-101449973 TTTTGGGTTTTTAGTAGAGTTGG - Intronic
1029727816 7:102419241-102419263 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1029839421 7:103346301-103346323 TTCTGTATTTGTAGTAGAGACGG + Intronic
1030050096 7:105530326-105530348 CTTGGGGTTGGTAGTAGATTGGG + Intergenic
1030068035 7:105675450-105675472 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1030521458 7:110603233-110603255 TTTTGTGTTTGTAGTAGAGACGG + Intergenic
1030845102 7:114400025-114400047 CTCTGTATTTTTAGTAGAGACGG + Intronic
1031135207 7:117876413-117876435 CTCTGGGTTTTTGGTTTAGTGGG - Intergenic
1031135678 7:117881418-117881440 TTCTGGATTTTTAGTAGAGGGGG + Intergenic
1031658641 7:124392322-124392344 CTATGGTTTTTTAGTAGTGTGGG + Intergenic
1032149778 7:129418469-129418491 TTTTGTGTTTTTAGTAGAGTCGG + Intronic
1033158613 7:138977868-138977890 CTCTGTATTTTTAGTAGAGACGG + Intronic
1033179084 7:139157315-139157337 CTTTGGATTTTTAGTAGAGATGG + Intronic
1033568760 7:142606166-142606188 CTCGTTGTTTGTAGTAGATTTGG - Intergenic
1033928358 7:146491657-146491679 CACTGGGTTTGTAAGAGAGTAGG - Intronic
1033950699 7:146781054-146781076 CTCTGTATTTTTAGTAGAGACGG - Intronic
1033997189 7:147365231-147365253 TTCTGTATTTGTAGTAGAGACGG - Intronic
1034180231 7:149131513-149131535 TTCTGTATTTGTAGTAGAGATGG - Intronic
1034327451 7:150249623-150249645 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1034642417 7:152614813-152614835 TTCTGAATTTTTAGTAGAGTTGG + Intergenic
1034765760 7:153719822-153719844 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1035141588 7:156768204-156768226 CTTTGTGTTTTTAGTAGAGACGG - Intronic
1035142531 7:156777105-156777127 CTCTGTATTTTTAGTAGAGATGG + Intronic
1035208839 7:157312746-157312768 CTCTGCATTTTTAGTAGAGATGG - Intergenic
1035251556 7:157600577-157600599 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1035267839 7:157701776-157701798 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035267855 7:157701874-157701896 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035267871 7:157701972-157701994 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035267903 7:157702168-157702190 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035847895 8:2884740-2884762 CTGTGTGTTTGTGGTAGAGCAGG + Intergenic
1035976876 8:4322822-4322844 TTGTGTGTTTGTAGGAGAGTTGG - Intronic
1036456998 8:8918361-8918383 TTTTGGATTTTTAGTAGAGTTGG - Intergenic
1036512079 8:9409894-9409916 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1036599049 8:10242099-10242121 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1037295244 8:17392697-17392719 GTCTGGGTGTGAACTAGAGTTGG + Intronic
1037487586 8:19363245-19363267 TTTTGTATTTGTAGTAGAGTTGG + Intronic
1038145759 8:24894102-24894124 TTTTGTGTTTGTAGTAGAGACGG - Intergenic
1039277571 8:35950699-35950721 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1039932971 8:42011565-42011587 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1040652092 8:49460426-49460448 TTTTGTGTTTGTAGTAGAGTCGG - Intergenic
1040912913 8:52539849-52539871 CCCTGGTATTGTAATAGAGTCGG + Exonic
1041109620 8:54472252-54472274 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
1041481633 8:58327894-58327916 TTTTGGGTTTTTAGTAGAGACGG - Intergenic
1041700895 8:60787990-60788012 TTTTGTGTTTTTAGTAGAGTTGG + Intronic
1041973133 8:63766447-63766469 CTATAGCTTTGTAGTATAGTTGG + Intergenic
1044090061 8:87989419-87989441 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1045363761 8:101456470-101456492 TTTTGTGTTTCTAGTAGAGTTGG - Intergenic
1046542147 8:115599495-115599517 CACTGGGCTTGTTGGAGAGTCGG - Intronic
1046604040 8:116350950-116350972 CTCAGGGTTTGGAGTAGAGACGG - Intergenic
1046631280 8:116625278-116625300 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1047491360 8:125377263-125377285 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1047756451 8:127922671-127922693 CACTGTGTTGGCAGTAGAGTGGG - Intergenic
1048892847 8:138963313-138963335 CTTTGTGTTTTTAGTAGAGTTGG + Intergenic
1049821006 8:144633284-144633306 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1050836386 9:10085039-10085061 CTCTGGGTGTGTAGTATGGTGGG + Intronic
1050877338 9:10654989-10655011 TTCTGGATTTTTAGTAGAGATGG + Intergenic
1051421318 9:16891996-16892018 CTCTGGGTTTATACAATAGTGGG - Intergenic
1051648938 9:19301006-19301028 CTTTGTGTTTTTAGTAGAGCAGG - Intronic
1051791904 9:20814525-20814547 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1051865586 9:21677204-21677226 TTTTGTGTTTTTAGTAGAGTTGG - Intergenic
1051873848 9:21769825-21769847 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1052116483 9:24653918-24653940 CACAAGGTTTGTAGTGGAGTGGG + Intergenic
1052205170 9:25830272-25830294 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1052786774 9:32835702-32835724 CTTTGTATTTGTAGTAGAGATGG - Intergenic
1052895854 9:33747881-33747903 CTTTGTATTTTTAGTAGAGTTGG - Intergenic
1053235122 9:36446634-36446656 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1053446833 9:38159184-38159206 CCCTTGGTTTGAAGTGGAGTGGG + Intergenic
1054703181 9:68434633-68434655 CTTTGTGTTTTTAGTAGAGATGG - Intronic
1055123088 9:72685532-72685554 TTTTGTGTTTGTAGTAGAGGCGG + Intronic
1055395696 9:75872170-75872192 GTCTAGGTGTGTAGTAGAGTAGG + Intergenic
1055541001 9:77305108-77305130 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1055615816 9:78071254-78071276 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1055733389 9:79302549-79302571 CTCTGAGTTGGGGGTAGAGTTGG + Intergenic
1056415206 9:86368814-86368836 TTCTGGATTTTTAGTAGAGATGG + Intergenic
1056790055 9:89619449-89619471 TTTTGGATTTTTAGTAGAGTTGG - Intergenic
1056880816 9:90391756-90391778 GTCTGGGATTTTAGTAGAATTGG - Intergenic
1056942750 9:90969276-90969298 CTCTGGCTTTGTAGGAGTCTGGG + Intergenic
1056982822 9:91332329-91332351 TTTTGTGTTTTTAGTAGAGTCGG - Intronic
1057484484 9:95471865-95471887 CTTTGTGTTTTTAGTAGAGATGG - Intronic
1059213122 9:112533401-112533423 CTTTGTATTTTTAGTAGAGTGGG - Intronic
1059687440 9:116651085-116651107 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1060373186 9:123094318-123094340 CTGTAGGTTTTTCGTAGAGTAGG + Intronic
1060634219 9:125187452-125187474 TTCTGTGTTTTTAGTAGAGAGGG + Intronic
1061085467 9:128395525-128395547 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1061453133 9:130679501-130679523 CTTTGCATTTGTAGTAGAGATGG + Intronic
1061468337 9:130801396-130801418 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1062404724 9:136390152-136390174 CTCTGGCTTTGTGGGAGGGTGGG - Intronic
1062750880 9:138252345-138252367 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1185534154 X:846328-846350 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1185570726 X:1132912-1132934 TTTTGGGTTTTTAGTAGAGACGG - Intergenic
1185608995 X:1383179-1383201 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1186382347 X:9074102-9074124 TTCTGGGTTTGCAGTACATTAGG - Intronic
1187174675 X:16885531-16885553 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1187560413 X:20397707-20397729 CCCTGGGGTTGTATTTGAGTTGG - Intergenic
1187900435 X:24022902-24022924 CTTTGTGTTTTTAGTAGAGACGG + Intronic
1188704667 X:33312502-33312524 TTCTGGGTTTTTAGTACTGTTGG + Intronic
1188848048 X:35098466-35098488 CTCTGTGATTATAGTAGAGCTGG + Intergenic
1189170135 X:38901144-38901166 TTTTGTGTTTGTAGTAGAGACGG + Intergenic
1189829334 X:44954625-44954647 ATGTGGGGTTGGAGTAGAGTGGG + Intronic
1190641325 X:52484059-52484081 CTCTGGGTTTTCAGTGGGGTGGG - Intergenic
1190646347 X:52528806-52528828 CTCTGGGTTTTCAGTGGGGTGGG + Intergenic
1190884351 X:54518379-54518401 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1191130920 X:57009643-57009665 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1191647837 X:63502871-63502893 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1192134814 X:68587130-68587152 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1192296105 X:69850277-69850299 CTGTGGCTTATTAGTAGAGTTGG + Intronic
1192856114 X:75014082-75014104 CTCAGGGATTGTAGTACAATAGG - Intergenic
1193487844 X:82108525-82108547 TTTTGGATTTGTAGTAGAGACGG + Intergenic
1193956367 X:87868831-87868853 TTCTGTATTTTTAGTAGAGTTGG - Intergenic
1194583897 X:95709928-95709950 CTCTAGCTTTATAGTATAGTGGG + Intergenic
1195216188 X:102705618-102705640 CTCTGTATTTTTAGTAGAGATGG + Intergenic
1196613648 X:117742862-117742884 CCCTGAGATTGTAGTACAGTGGG + Intergenic
1197195242 X:123693286-123693308 GTGTGTGTTTTTAGTAGAGTTGG - Intronic
1197205718 X:123788349-123788371 TTTTGTGTTTTTAGTAGAGTTGG + Intergenic
1197253211 X:124236012-124236034 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1197795012 X:130289350-130289372 TTTTGTATTTGTAGTAGAGTTGG + Intergenic
1199225208 X:145364900-145364922 TTTTGGGTTTTTAGTAGAGACGG + Intergenic
1199798339 X:151224750-151224772 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1199899200 X:152156707-152156729 CCCTGGGTCTGTTGTAAAGTGGG + Intergenic
1200243914 X:154512730-154512752 CTCTGGGTTGGGAGTTGACTTGG - Intronic
1200905933 Y:8482815-8482837 TTTTGGATTTGTAGTAGAGGTGG - Intergenic
1202104353 Y:21347049-21347071 CTCTGGGATTTCAGAAGAGTGGG + Intergenic
1202339320 Y:23844676-23844698 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1202531446 Y:25825392-25825414 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1202585272 Y:26417433-26417455 TTCTGTATTTGTAGTAGAGAGGG - Intergenic