ID: 1164198393

View in Genome Browser
Species Human (GRCh38)
Location 19:22993979-22994001
Sequence AAGTGTTACCTGAACATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 2, 2: 2, 3: 19, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164198392_1164198393 -1 Left 1164198392 19:22993957-22993979 CCTGCATGGGTAAAATAGCAGCA 0: 1
1: 1
2: 5
3: 75
4: 1765
Right 1164198393 19:22993979-22994001 AAGTGTTACCTGAACATTTGTGG 0: 1
1: 2
2: 2
3: 19
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164198393 Original CRISPR AAGTGTTACCTGAACATTTG TGG Intronic
900202251 1:1414407-1414429 AAATGTAACCTTAAAATTTGAGG - Intergenic
901347934 1:8563871-8563893 AAGAGTTGTCTGAACATTAGAGG + Intronic
902345789 1:15816346-15816368 AAGTGTTTCCTGAGCACTGGGGG + Intergenic
905637738 1:39566318-39566340 ATTGGTTACCTGAACATTTTAGG - Intronic
905767258 1:40611486-40611508 TAGTGTTGCCTGAGGATTTGGGG - Intergenic
906660031 1:47575403-47575425 AAGTGTTGCATATACATTTGTGG + Intergenic
907423096 1:54360657-54360679 AGCTGTTACCTAAACATTTTGGG - Intronic
908516635 1:64898791-64898813 AGGTGCTCCCTGAACATTTCTGG + Intronic
908696618 1:66849483-66849505 AATTGAAACCTGGACATTTGGGG - Intronic
909975874 1:82045784-82045806 AAGGCTTACCTGAACACTAGAGG - Intergenic
909984529 1:82144338-82144360 AAGTGTTATCAGAATAGTTGTGG - Intergenic
911037331 1:93564879-93564901 AAGAGTTGCCTGAACATCTTTGG - Intronic
912056534 1:105605926-105605948 AAGTCTTACCTGAAGAGTGGAGG + Intergenic
912828388 1:112927237-112927259 AAGGGTCACCTTAACACTTGTGG - Intronic
913983504 1:143544732-143544754 CAGTGTTCCCTAAACATATGTGG + Intergenic
917899285 1:179526088-179526110 AAGTGTTATCTGAAAAAATGTGG - Intronic
919228486 1:194740053-194740075 AAGTCTTAACAAAACATTTGTGG - Intergenic
919326912 1:196119633-196119655 AAATTTTATCTGAACATTTGAGG - Intergenic
919484190 1:198126992-198127014 AGGAGATACCTGAACATTGGTGG - Intergenic
919501814 1:198346842-198346864 AACTGTCACCTGGACATTTTGGG + Intergenic
920711770 1:208302209-208302231 AAGTGTTATCAAACCATTTGGGG + Intergenic
921502688 1:215925173-215925195 AAGTGTTACCTTTACTTTTTTGG - Intronic
921636238 1:217497642-217497664 AAATGATTCCTGAAGATTTGAGG + Intronic
923942804 1:238846632-238846654 AAGAGTTAAATGAACAATTGTGG - Intergenic
924503616 1:244659836-244659858 AATTTTTAACTGAACATTTTTGG - Intronic
1062956728 10:1545360-1545382 CAGTGTGATCTGAACATTTGGGG + Intronic
1063572769 10:7231432-7231454 AAGTTTTATCTGAACATGTATGG - Intronic
1063631880 10:7741567-7741589 AGGTGTGAACTGAACATTTCTGG + Intronic
1065396339 10:25242552-25242574 AAGTGTTAACAGAAGCTTTGTGG + Intronic
1066975095 10:42360884-42360906 AGGTGTTAACTGCACATTTATGG + Intergenic
1068527579 10:58147996-58148018 AAGTGTTGCTTGAAGACTTGAGG - Intergenic
1069278781 10:66627066-66627088 AAGAATGACCTGAACATGTGTGG + Intronic
1069362950 10:67664288-67664310 AATTTTTTTCTGAACATTTGGGG + Intronic
1071075523 10:81746760-81746782 AAGTTTTGCATGCACATTTGCGG - Intergenic
1071255613 10:83869296-83869318 AGGTGATCTCTGAACATTTGGGG + Intergenic
1072332709 10:94369337-94369359 AACTGTGAACTGCACATTTGAGG - Intergenic
1072529507 10:96305612-96305634 TAGTTTTGCCTGAAAATTTGTGG - Intronic
1073591535 10:104762231-104762253 ACATGTTGCCTGACCATTTGTGG + Intronic
1073722850 10:106193763-106193785 AAGGTTTACCTGTAAATTTGTGG - Intergenic
1075907258 10:126092455-126092477 AATTGTTTGCTGGACATTTGGGG - Intronic
1076172693 10:128335559-128335581 AAATGTTAGCTGAGCGTTTGTGG - Intergenic
1077745050 11:4893484-4893506 AAGAGTGACCCAAACATTTGTGG - Intronic
1078503666 11:11910837-11910859 AATTGAAACCTGGACATTTGGGG - Intronic
1079844695 11:25450902-25450924 AAGTGTTAATTAAACTTTTGTGG + Intergenic
1080741649 11:35069810-35069832 AATTAAAACCTGAACATTTGTGG - Intergenic
1081355770 11:42111382-42111404 AAGAGTTACCAGAAAATTCGAGG - Intergenic
1081626973 11:44661943-44661965 ATGTGTTATCTGCACATCTGTGG + Intergenic
1086087100 11:82966591-82966613 AATTTTTGCCTTAACATTTGTGG - Intronic
1087844683 11:102959858-102959880 AAGTGTTCCGTGCACATTTAAGG - Intergenic
1089036398 11:115397919-115397941 AAGTCTTCCCTGAATATTTGGGG + Intronic
1093806113 12:23435146-23435168 AAGTGTTGCCTGATATTTTGGGG - Intergenic
1098676539 12:73295930-73295952 CAGTTTCACCTGAACTTTTGTGG + Intergenic
1099354237 12:81613301-81613323 AAGAGTTACCTGAGCAATTTGGG + Intronic
1099652079 12:85441511-85441533 AAATATTATTTGAACATTTGTGG - Intergenic
1101255866 12:102975902-102975924 AAGAGCTCCATGAACATTTGTGG - Intergenic
1102845234 12:116174129-116174151 AACTTTTGCCTGAAAATTTGGGG - Intronic
1104199053 12:126569790-126569812 AAGGCTTATCTGAACATTTTCGG - Intergenic
1104962583 12:132495281-132495303 AAGTGTGACCTGGCCATGTGGGG + Intronic
1105230510 13:18490880-18490902 AGGTGTTAACTGCACATTTTTGG + Intergenic
1106811639 13:33364123-33364145 AAGTGTAAACTGTAGATTTGGGG - Intergenic
1107391648 13:39971117-39971139 AAGTGGTATCTGAAAATTTCGGG - Intergenic
1108799603 13:54079006-54079028 AAATGCTACCTAAACATTAGGGG - Intergenic
1109522124 13:63527417-63527439 AAGTGTTACCCAAACACTGGGGG + Intergenic
1111950431 13:94705171-94705193 AAGTGTAACCTGAGCCTTCGCGG - Intergenic
1113601653 13:111573647-111573669 CAGTGTTTCCTGTACGTTTGCGG - Intergenic
1116641655 14:47470973-47470995 AAGTGTTATCTGAAGGTTGGTGG + Intronic
1117251269 14:53941592-53941614 TATTGTTACCTTAAAATTTGGGG + Intergenic
1117722544 14:58641734-58641756 AATTCTTACCTGCAGATTTGGGG - Exonic
1119627700 14:76195055-76195077 AAGTGTTCCTTGAACATTTGGGG - Intronic
1120700399 14:87692529-87692551 AAAAGTTATCTCAACATTTGTGG - Intergenic
1121737874 14:96231225-96231247 AAGTGTTTCCAGAACATTCCAGG + Intronic
1123887681 15:24743008-24743030 AAGGGTTACTTGAAAGTTTGTGG - Intergenic
1124176829 15:27433949-27433971 TTGTGTTTCCTAAACATTTGGGG - Intronic
1124822890 15:33065240-33065262 AAGTGTAACGTGATCAGTTGAGG + Intronic
1125334236 15:38612118-38612140 AAATCATACCTGAACATTGGAGG - Intergenic
1125433032 15:39616523-39616545 AAGGGGTACCTGAACATTTCTGG + Intronic
1126673100 15:51134371-51134393 AACTGTTATCTGGACCTTTGTGG + Intergenic
1127275486 15:57439588-57439610 TAGTGTTACCTGAGTATTTGAGG - Exonic
1127800527 15:62473416-62473438 AAGAGTAACATGAACATCTGCGG + Intronic
1128644125 15:69362405-69362427 TAGTTTTACCTGAGGATTTGGGG + Intronic
1129000117 15:72326059-72326081 AATTGATTCCTGAACATTTTGGG + Intronic
1129082113 15:73051478-73051500 ACGTTTTACCTGTACCTTTGCGG - Intergenic
1130371431 15:83288144-83288166 AAGGTTTACCTGCCCATTTGCGG - Intergenic
1130668873 15:85892737-85892759 AAGTGTTAATTCAACAGTTGAGG + Intergenic
1130813662 15:87407980-87408002 AAGTTTTATCTAAAAATTTGGGG - Intergenic
1131012501 15:89030606-89030628 CAGTGCTACCTGAAGAGTTGTGG + Intergenic
1131302840 15:91214763-91214785 AAGTGTTCCCCAAACAGTTGTGG + Intronic
1131499152 15:92944701-92944723 AAGTATGACCTCAAGATTTGTGG + Intronic
1131670047 15:94610288-94610310 GAGTGTTTCATCAACATTTGGGG - Intergenic
1132424987 15:101708603-101708625 ATCTATTTCCTGAACATTTGAGG - Intronic
1133510472 16:6452568-6452590 AAGTGATACCTGAACAATAGGGG + Intronic
1136226865 16:28865665-28865687 AAGTGTGACATGAATATTGGAGG + Intronic
1137037953 16:35582648-35582670 AGGGGTTATCTGCACATTTGTGG + Intergenic
1138841601 16:60515467-60515489 AAGTGTTCCCTGGATATTTGGGG - Intergenic
1143251843 17:5528540-5528562 AATTGTTTACTGAACTTTTGTGG + Intronic
1144152961 17:12468589-12468611 AAGTGTTGCCTGGAAATTAGTGG - Intergenic
1149878332 17:60261828-60261850 AATTGTTCCTTGAATATTTGTGG - Intronic
1151862540 17:76775734-76775756 AAGTGTTATTAGAACATTTCAGG + Intronic
1154522894 18:15248988-15249010 AGGTGTTAACTGCACATTTATGG - Intergenic
1158056732 18:53290098-53290120 TATTGTCACCTGAACATTTATGG + Intronic
1161757302 19:6143600-6143622 AGGTGTCACCTGGACACTTGTGG - Intronic
1163904058 19:20135947-20135969 AGGTGTTAACTGCACATTTGTGG + Intergenic
1163936041 19:20444839-20444861 AGGTTTTACCTGCACATTTGTGG - Intergenic
1163970239 19:20786489-20786511 AGGTATTACCTGTACGTTTGTGG - Intronic
1164022055 19:21316510-21316532 AGGTATTACTTGCACATTTGTGG + Intronic
1164094680 19:21996645-21996667 AGGTGTTACCTGAACATTTGTGG + Intronic
1164102268 19:22067383-22067405 AGGTGTTACCTGCATATTTGTGG - Intronic
1164114252 19:22202123-22202145 AGGTGGTATCTGAATATTTGTGG + Intergenic
1164124595 19:22300849-22300871 AGGTTTTCCCTGCACATTTGTGG - Intronic
1164140675 19:22459221-22459243 AGGTGGTACCTGCACATTTGTGG - Intronic
1164175775 19:22772860-22772882 AGGTGTTCCCTGCACATCTGTGG + Intronic
1164183624 19:22841815-22841837 AGGTGTTACTTGCATATTTGTGG - Intergenic
1164198393 19:22993979-22994001 AAGTGTTACCTGAACATTTGTGG + Intronic
1164232909 19:23306878-23306900 GAGAGTCACCTGAACCTTTGAGG - Intronic
1165268168 19:34678828-34678850 AAGTGTTTCAGGAAGATTTGGGG - Intronic
1165274374 19:34735061-34735083 AAGTGTTTCAGGAAGATTTGCGG - Intronic
1165613090 19:37173830-37173852 AAGTTCTACCTGAACAGTGGTGG + Intronic
925595040 2:5547259-5547281 AAGTGTTTCCTGATCATTTGAGG + Intergenic
927332657 2:21883975-21883997 AAGTTTGACCTCAACATTTAGGG + Intergenic
930102967 2:47617422-47617444 TGGTGTTGCCTGCACATTTGAGG - Intergenic
930225445 2:48787707-48787729 AAGTGTTCAATGAACGTTTGTGG + Intergenic
931693025 2:64851439-64851461 GTGTGTTACCTGAGCACTTGAGG + Intergenic
936716683 2:115194734-115194756 CAGTGTTCTGTGAACATTTGTGG + Intronic
938522183 2:132081835-132081857 AGGTGTTAACTGCACATTTATGG - Intergenic
943733371 2:191327046-191327068 AAATATTATCTGAACATTGGAGG + Intronic
944395826 2:199264902-199264924 AAGTGTTACCTTCACATATGGGG - Intergenic
944865047 2:203851707-203851729 AAGAGCTGCCTGAACTTTTGTGG + Intergenic
944887164 2:204074973-204074995 AAGTGTTACTTCAACTTTTGAGG - Intergenic
945468139 2:210195278-210195300 ATGTGTAACCCGAGCATTTGTGG - Exonic
945483258 2:210366414-210366436 AAGGGATAGCAGAACATTTGGGG - Intergenic
945577791 2:211553934-211553956 AAGTGCTAGATGAATATTTGTGG - Intronic
945645302 2:212484765-212484787 TAGTGTTACCAGAATACTTGAGG - Intronic
946210043 2:218140093-218140115 AAATATCACCTGAACCTTTGTGG - Intergenic
948329720 2:237155444-237155466 AAGTGTGACATGAACAGTTCAGG + Intergenic
1169705498 20:8499005-8499027 AAGTGGTACAGGAAGATTTGTGG - Intronic
1170385853 20:15815918-15815940 AATTGTAACCTGAATATCTGAGG + Intronic
1175662424 20:60825326-60825348 AAGTCTTACCTGTACATGAGGGG + Intergenic
1176774501 21:13119227-13119249 AGGTGTTAACTGCACATTTATGG + Intergenic
1176981392 21:15385192-15385214 ATATGTTAACTGACCATTTGGGG + Intergenic
1177543863 21:22531359-22531381 CAGAGTTGCCTGAACATTCGTGG + Intergenic
1177615973 21:23520426-23520448 AATTGTTGCCTGAACTTTTGGGG + Intergenic
1177874211 21:26611233-26611255 AAGGCTTATCTGAACATTGGAGG + Intergenic
1178934627 21:36850789-36850811 AAATGTAGCATGAACATTTGAGG - Intronic
1179146576 21:38773776-38773798 AATTGTTTTCTTAACATTTGGGG - Intergenic
1180007695 21:45030714-45030736 AAGTGGGAAATGAACATTTGGGG - Intergenic
1185311964 22:50161210-50161232 CACTGTTTCCTGGACATTTGGGG + Intronic
949241254 3:1875093-1875115 AATTATTAACTGTACATTTGAGG - Intergenic
949537748 3:5008845-5008867 AATTGAGATCTGAACATTTGAGG - Intergenic
951178475 3:19630467-19630489 AAATGTTAATTTAACATTTGAGG - Intergenic
951388320 3:22070120-22070142 AAGTTCTAAGTGAACATTTGTGG - Intronic
953062533 3:39439154-39439176 AAGTTTTATCAGATCATTTGGGG - Intergenic
953320968 3:41971172-41971194 CAGTGTTTGCTGCACATTTGGGG - Intergenic
956411865 3:68987767-68987789 GTATGTTACATGAACATTTGGGG + Intronic
961429991 3:126874705-126874727 ATCTGTTACCTGGACCTTTGTGG + Intronic
963080523 3:141389095-141389117 AAGTGCACCCTGAACCTTTGTGG + Intronic
964125966 3:153233756-153233778 AAGTTTCAACTGCACATTTGAGG - Intergenic
966018956 3:175182765-175182787 TTTTGTTACCTGAACTTTTGGGG + Intronic
966702419 3:182869852-182869874 ACTTGTTAGCTGGACATTTGGGG - Intronic
970743388 4:19265359-19265381 AAGTGTGACTTCAACGTTTGGGG - Intergenic
972700280 4:41487600-41487622 AAGTGGTACATGAACAATTTAGG + Intronic
974242426 4:59267283-59267305 AAATGTTACCTGAGGATTTTCGG - Intergenic
975064513 4:70043514-70043536 ATTTGTTGCCTGAACATGTGGGG - Intergenic
975704038 4:77094105-77094127 AAGTGTCTTCTGAACACTTGAGG + Intergenic
975939767 4:79628661-79628683 AAGTTAGACCAGAACATTTGAGG - Intergenic
976383024 4:84421742-84421764 AAGTGTCATCAGAACATTTTAGG - Intergenic
976982101 4:91244095-91244117 GAGTTTTAAATGAACATTTGTGG + Intronic
979301854 4:119095502-119095524 AAATGTTACCTGAACACTAGTGG + Intergenic
979666260 4:123314263-123314285 CAGTTTTACCTGGAAATTTGTGG + Exonic
984439325 4:179746646-179746668 CTGTGTTACCTGAAAATGTGTGG - Intergenic
984509554 4:180661900-180661922 AAGTGTTAGGTGAGGATTTGAGG - Intergenic
984728544 4:183044401-183044423 TTTTGTTGCCTGAACATTTGGGG - Intergenic
989829787 5:45901426-45901448 AAATGTTTACTGAATATTTGGGG - Intergenic
992367988 5:76112708-76112730 AAGTGTTTCCTCAACATATTTGG + Intronic
993811276 5:92479897-92479919 GAGTGTTACATGTACACTTGAGG - Intergenic
994466408 5:100138718-100138740 AAGTGTAAAATGAACATATGAGG + Intergenic
995804229 5:116033407-116033429 AAGTGTTCTCAGAACATTTGAGG + Intronic
997307938 5:132853689-132853711 AAGTGTCAACTGTACATTTTGGG - Intergenic
1001073901 5:168609638-168609660 AAGTGTTATCTGAATTTCTGGGG + Intergenic
1001822773 5:174723022-174723044 AAGTATTACCTGAATCTTAGAGG - Intergenic
1005269190 6:24145409-24145431 AAGTGTTTCCTGCAAATTTGGGG + Intronic
1005412943 6:25569682-25569704 ATGTGTTACCTGAAGAATTTAGG + Intronic
1006803401 6:36773550-36773572 AGGGGTTCCCTAAACATTTGTGG + Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1008185048 6:48378297-48378319 AAGTATTACCTGAAGTTTTCTGG - Intergenic
1008607678 6:53156281-53156303 AAGGGTGACCTGATCACTTGAGG - Intergenic
1008909154 6:56714737-56714759 AAATGTCTCCTGAATATTTGAGG + Intronic
1011272979 6:85598791-85598813 AACTGTTCTCTGAACATCTGGGG - Intronic
1015305630 6:131704142-131704164 AAGTGTTTTCTGAATGTTTGGGG - Intronic
1020534444 7:9377518-9377540 AAGAATAACCAGAACATTTGGGG + Intergenic
1021887260 7:25151676-25151698 AAGGATTACCTGAAAATTTCAGG + Exonic
1025866113 7:65382741-65382763 AAGTGTTACCTGCACATTTGTGG - Intronic
1026264401 7:68783621-68783643 AAGATTTACCTAAAAATTTGGGG - Intergenic
1027868482 7:83676039-83676061 ATCTGTTACCTGAACCTTTCTGG + Intergenic
1028890600 7:95983925-95983947 AACTGTCAGCTGAACCTTTGTGG - Intronic
1030412272 7:109196324-109196346 AAGTGTTATCAGCACATTTAAGG - Intergenic
1031537157 7:122949005-122949027 AAGAGTTACCTAAATTTTTGTGG + Intergenic
1031713768 7:125081335-125081357 AAGTCTTTGCTGAACTTTTGGGG + Intergenic
1032838109 7:135692261-135692283 AAGTCTTGCCTGAAGAATTGGGG + Intronic
1033709282 7:143923981-143924003 AAGCTGTACATGAACATTTGTGG + Intergenic
1033739746 7:144262373-144262395 AAGTGTTTTCTGAATGTTTGGGG - Intergenic
1035131417 7:156657771-156657793 ATCTGTTACATAAACATTTGTGG - Intronic
1035734314 8:1876737-1876759 ACGTGTTCCCTGCACATGTGAGG + Intronic
1035901890 8:3465602-3465624 AAGTGTGATCCGAAGATTTGAGG + Intronic
1036975869 8:13411907-13411929 AACTTTTACCTAAGCATTTGTGG - Intronic
1038516400 8:28191203-28191225 AACTGAAACCTGCACATTTGTGG - Intergenic
1038562255 8:28590627-28590649 AAGTGTTCCGAGAACATTTAAGG + Intergenic
1039727944 8:40241126-40241148 AAGTGTTATCTTAAAGTTTGTGG + Intergenic
1042007867 8:64202548-64202570 AGGTGTTTCCTGAAAAATTGGGG - Intergenic
1042111895 8:65389782-65389804 AAGTTTAACCTGAGCATTTCAGG + Intergenic
1042351515 8:67782046-67782068 AACTGTTACATGAATATTTGCGG + Intergenic
1043064630 8:75552739-75552761 AAGTTTTACCCCAACTTTTGAGG - Intronic
1044173212 8:89082628-89082650 CAGTGTTACCTCAATATTTATGG + Intergenic
1044682068 8:94790387-94790409 AAATGTTAGCTGAAGATATGTGG + Exonic
1047612549 8:126535244-126535266 AAATGTTTGGTGAACATTTGTGG + Intergenic
1047768794 8:128013505-128013527 AAGTGTTCAATAAACATTTGTGG - Intergenic
1051968059 9:22853418-22853440 AAGTATTGCCTAAACATATGGGG - Intergenic
1053438135 9:38091100-38091122 AAGTGTTACTAGAACATTAAAGG - Intergenic
1055144071 9:72911740-72911762 CTGTGTTGGCTGAACATTTGTGG + Intronic
1056432669 9:86543650-86543672 ATGTGTGACCTGAGCATCTGTGG + Intergenic
1059707029 9:116835088-116835110 TAATGTGACCTGAACATTTCTGG + Intronic
1186444928 X:9619214-9619236 AAGTCTGGCCTGAACATTGGTGG + Intronic
1188411243 X:29874286-29874308 AAGTGTTTCATAAATATTTGGGG + Intronic
1188618614 X:32191658-32191680 ATATGTCACTTGAACATTTGTGG - Intronic
1188706230 X:33335177-33335199 AAGAGGAACCTTAACATTTGGGG - Intronic
1189452526 X:41151044-41151066 AAGTCTTACCTCAAATTTTGAGG - Exonic
1190828941 X:54043690-54043712 GTGAGGTACCTGAACATTTGGGG - Intronic
1191175818 X:57500773-57500795 AAATGGTACCTGAAAAATTGTGG - Intergenic
1194003561 X:88462486-88462508 TTTTGTTACCTGAACTTTTGAGG - Intergenic
1195455030 X:105058490-105058512 ACATGTTACCTGAACATATGTGG + Intronic
1197538056 X:127716134-127716156 TTGTGTTGCCTGAACTTTTGGGG - Intergenic
1198232995 X:134710787-134710809 AAGTGCTACATGAAAAGTTGAGG - Intronic