ID: 1164203270

View in Genome Browser
Species Human (GRCh38)
Location 19:23036128-23036150
Sequence CCTTTTAAGCAGTCAGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164203264_1164203270 12 Left 1164203264 19:23036093-23036115 CCAGGAAAGTGAGCCCCAGACAA No data
Right 1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG No data
1164203267_1164203270 -3 Left 1164203267 19:23036108-23036130 CCAGACAAAGAAAGCAGCCACCT 0: 7
1: 1
2: 4
3: 20
4: 187
Right 1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG No data
1164203266_1164203270 -2 Left 1164203266 19:23036107-23036129 CCCAGACAAAGAAAGCAGCCACC No data
Right 1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG No data
1164203265_1164203270 -1 Left 1164203265 19:23036106-23036128 CCCCAGACAAAGAAAGCAGCCAC No data
Right 1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164203270 Original CRISPR CCTTTTAAGCAGTCAGCAGC CGG Intergenic
No off target data available for this crispr