ID: 1164207854

View in Genome Browser
Species Human (GRCh38)
Location 19:23072837-23072859
Sequence GGGGTTTACCCACACCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164207845_1164207854 22 Left 1164207845 19:23072792-23072814 CCACTTGAGTGGGAAGCAAGAGA No data
Right 1164207854 19:23072837-23072859 GGGGTTTACCCACACCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164207854 Original CRISPR GGGGTTTACCCACACCAGGT TGG Intergenic
No off target data available for this crispr