ID: 1164210445

View in Genome Browser
Species Human (GRCh38)
Location 19:23093531-23093553
Sequence CCCCACCCCCAAGAATGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 284}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164210445_1164210455 4 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210455 19:23093558-23093580 TGGCAGCTTGATCCCCGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1164210445_1164210465 18 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210465 19:23093572-23093594 CCGGGCTGGGACAGGGCTGGGGG 0: 1
1: 0
2: 10
3: 98
4: 781
1164210445_1164210457 10 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210457 19:23093564-23093586 CTTGATCCCCGGGCTGGGACAGG 0: 1
1: 0
2: 4
3: 17
4: 215
1164210445_1164210459 15 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210459 19:23093569-23093591 TCCCCGGGCTGGGACAGGGCTGG 0: 1
1: 0
2: 4
3: 52
4: 495
1164210445_1164210458 11 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210458 19:23093565-23093587 TTGATCCCCGGGCTGGGACAGGG 0: 1
1: 0
2: 1
3: 27
4: 175
1164210445_1164210454 0 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210454 19:23093554-23093576 GTGGTGGCAGCTTGATCCCCGGG 0: 1
1: 0
2: 2
3: 17
4: 167
1164210445_1164210453 -1 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210453 19:23093553-23093575 GGTGGTGGCAGCTTGATCCCCGG 0: 1
1: 0
2: 1
3: 31
4: 226
1164210445_1164210463 17 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210463 19:23093571-23093593 CCCGGGCTGGGACAGGGCTGGGG 0: 1
1: 0
2: 4
3: 89
4: 813
1164210445_1164210461 16 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210461 19:23093570-23093592 CCCCGGGCTGGGACAGGGCTGGG 0: 1
1: 0
2: 8
3: 58
4: 638
1164210445_1164210456 5 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210456 19:23093559-23093581 GGCAGCTTGATCCCCGGGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 102
1164210445_1164210466 25 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210466 19:23093579-23093601 GGGACAGGGCTGGGGGAGCCTGG 0: 1
1: 1
2: 16
3: 158
4: 1201
1164210445_1164210467 30 Left 1164210445 19:23093531-23093553 CCCCCTCATTCTTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 31
4: 284
Right 1164210467 19:23093584-23093606 AGGGCTGGGGGAGCCTGGTGTGG 0: 1
1: 0
2: 7
3: 91
4: 819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164210445 Original CRISPR CCCCACCCCCAAGAATGAGG GGG (reversed) Intronic
900205680 1:1431093-1431115 CCCCACCCCCAGGACAGAAGAGG + Intergenic
900350074 1:2230127-2230149 CCCCAACCCCAAGAAAGACCTGG - Intronic
901868430 1:12123345-12123367 CCCCACCCCAGAGAATGGCGAGG + Exonic
902288588 1:15422393-15422415 CCCCACCGCAAAGAATGACCTGG - Intronic
902731001 1:18368799-18368821 CCACCCCACCAAGAATAAGGAGG + Intronic
903231536 1:21925398-21925420 CCCAAGCCCCCAGTATGAGGGGG + Intronic
903499332 1:23792916-23792938 CCCCACCCCCAAGGACCTGGGGG - Intronic
903835592 1:26201342-26201364 CTCCACCCCCAGGATTGTGGAGG + Exonic
905908612 1:41638706-41638728 CCCCACCCAAAATCATGAGGAGG + Intronic
906529194 1:46513457-46513479 CCTCATTCCCAAGATTGAGGAGG + Exonic
906645084 1:47469041-47469063 CCCCACCCCTAAGAAGGGGGTGG - Intergenic
908484461 1:64576951-64576973 CCCACCTCCCAAGAAAGAGGTGG - Intronic
910289925 1:85589611-85589633 CCCCAACCCCAAGAATGCTGTGG - Intergenic
910850904 1:91649138-91649160 CGCCACCCCCAGGAAGGAGAGGG - Intergenic
911155736 1:94635068-94635090 CCCCAGCAGGAAGAATGAGGGGG - Intergenic
911647416 1:100351893-100351915 CCCCACGCCCAACACTGAGGGGG - Intronic
913323258 1:117605579-117605601 CCCTGCCCCCAGGAGTGAGGCGG - Intergenic
914806450 1:150995522-150995544 CCCCACACCCAAGAAGGAGCTGG - Exonic
915433022 1:155881367-155881389 TCGCACCACCAAGAATGAGGTGG + Exonic
916787560 1:168097484-168097506 CCACACCCCCAAATATGAGTGGG - Intronic
917034458 1:170732007-170732029 CCCCACTTCCAAGAATAAGTGGG + Intronic
918279236 1:182987037-182987059 TCCCAGGCCCAAGAAGGAGGAGG - Intergenic
922591488 1:226780550-226780572 CCTCACCCCCATCCATGAGGCGG - Intergenic
923212491 1:231816973-231816995 CCCCACCTCAAAGAAGGAGAGGG - Intronic
1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG + Intronic
1064362887 10:14681589-14681611 CCGCACCCAGAGGAATGAGGGGG + Intronic
1064405157 10:15055326-15055348 CCCCACCCACACAAACGAGGTGG - Intronic
1067363624 10:45604614-45604636 CTCCACTCCCAAGGAGGAGGAGG - Intergenic
1069603602 10:69725611-69725633 CCCCAGCAGCAAGAGTGAGGAGG + Intergenic
1069822559 10:71236630-71236652 CCCAGCACCCATGAATGAGGAGG - Intronic
1070054831 10:72924594-72924616 CCCCACCTCCAAGATCGACGAGG + Exonic
1070223290 10:74473814-74473836 CCCCACCCCCAAGTGTGGGGTGG - Intronic
1070386339 10:75928149-75928171 CCCCCACCCCAAGAGTTAGGTGG - Intronic
1070476824 10:76836900-76836922 CCCCAGCACCAGGAATGATGTGG - Intergenic
1070769938 10:79076349-79076371 CCCCACCCCCAAGGTTCAGCTGG - Intronic
1070831037 10:79418289-79418311 CCACACCCCCATGCATGAAGTGG - Intronic
1071905553 10:90169787-90169809 CTCCACCCCTCAGAATCAGGGGG + Intergenic
1072990153 10:100185536-100185558 CTCCATCCACAAGATTGAGGAGG - Exonic
1074508817 10:114094901-114094923 CCCCACCCCGAAGAGGGAGATGG + Intergenic
1075551280 10:123394572-123394594 CCCACCCCCAAAAAATGAGGAGG + Intergenic
1075572654 10:123557080-123557102 CCCCACTCTCAACAATGAGGCGG + Intergenic
1075789720 10:125075299-125075321 CCCCACCTCCCAGAATGATGGGG - Intronic
1076286428 10:129302003-129302025 CCCCAGCCCCTTGAATGTGGTGG - Intergenic
1076776223 10:132699611-132699633 CCCCACCCCCAAGAGCTATGGGG - Intronic
1077035295 11:491537-491559 CCCCACCCCCCAGAGAGAGCAGG + Intergenic
1080940567 11:36913458-36913480 CCCCACCCCCGAGAAAAGGGAGG + Intergenic
1083095034 11:60241875-60241897 CCCCACCCCGGATAAAGAGGTGG + Intronic
1083184735 11:61010887-61010909 CCCCACCCCCCACAGTAAGGAGG - Intronic
1083463743 11:62832079-62832101 CCCCACCCCCAGTGACGAGGGGG + Exonic
1083918465 11:65766054-65766076 CCCCACCTCCAACATTGGGGTGG - Intergenic
1083996543 11:66275896-66275918 CCTCACCACCAAGAAGGTGGTGG + Exonic
1085043462 11:73340309-73340331 CCCTGCCCCCAAGAAGGGGGCGG - Intronic
1085123321 11:73981357-73981379 CCCCACCCCCGACAGTGAAGTGG - Intronic
1086312885 11:85555548-85555570 ACCCACCTCCAAGTACGAGGAGG + Intronic
1087666429 11:101053924-101053946 CCCAAGCCCAAAGAAGGAGGAGG - Intronic
1089253591 11:117181855-117181877 GCCCCCCACCAAGAATGAGTCGG + Exonic
1089703430 11:120259647-120259669 CCTCACTCCTAAGAAGGAGGTGG + Intronic
1090189905 11:124760808-124760830 CCCCACCCCCCACAAGGAAGGGG + Intronic
1090285527 11:125496066-125496088 CCCCACCCCCAGCAGTGAGTCGG + Intronic
1090405230 11:126472519-126472541 CCTAACCCCCAAGTATGAGGAGG - Intronic
1090905211 11:131068737-131068759 CCCCAGCCCCAGGAATGACATGG + Intergenic
1091284910 11:134403183-134403205 CCCCTCCCCCAGGTATGTGGAGG - Intronic
1092659218 12:10721757-10721779 CCCCACCCCAAATAGTGAAGAGG + Intronic
1094130515 12:27069685-27069707 ACCCAGGCACAAGAATGAGGTGG + Intergenic
1096612354 12:52810806-52810828 GCCCACCCCCAGGTATGAAGAGG - Exonic
1096870189 12:54588120-54588142 CCCCTCCCCCAGGACTGGGGAGG + Intronic
1099347693 12:81523637-81523659 TACCACCCCCAGGAATGAGAAGG - Intronic
1102313786 12:111869025-111869047 CCCCACCCCCAAGTATAAAAGGG - Intronic
1102373780 12:112404446-112404468 CCCCACCTCCCAAAATGTGGGGG + Intergenic
1102602566 12:114043199-114043221 CCCCATCCCCAACAAAAAGGAGG - Intergenic
1102622279 12:114205595-114205617 CCCCGCCCCCAAGAATTATCTGG + Intergenic
1102688275 12:114741012-114741034 CCACACCCCCAAGAAAAAGGAGG - Intergenic
1103592581 12:122002823-122002845 CACCATCACCAAGACTGAGGAGG + Intronic
1104773013 12:131376022-131376044 GCCCATGCCCTAGAATGAGGGGG - Intergenic
1104931204 12:132340402-132340424 CCCCACCCGCCATGATGAGGGGG + Intergenic
1105957871 13:25301193-25301215 CCCCATCCCTAAGAAGGAAGGGG - Intergenic
1106780787 13:33057088-33057110 CCCCAACCCCAGTAAAGAGGAGG - Intronic
1106801750 13:33263156-33263178 CCCCACACCAAAGAATTATGTGG - Intronic
1108848144 13:54699591-54699613 CCCAACACTCAAGGATGAGGGGG + Intergenic
1110688817 13:78407135-78407157 CCTCACCCACAACAATGGGGAGG + Intergenic
1112285068 13:98096805-98096827 CACCACCCCTAGGAATGAGCCGG + Intergenic
1113585037 13:111459069-111459091 CCACACTCCCAGGAAGGAGGCGG - Intergenic
1115165890 14:30448422-30448444 CCCCACCCCCAGGATTTAGGAGG + Intergenic
1115713212 14:36073128-36073150 CCCCACACCCAAGCAGGATGAGG - Intergenic
1116232023 14:42229475-42229497 CCCCACCCTCCAGACTGATGTGG - Intergenic
1118864314 14:69690972-69690994 CCCCACCCCCCAGAATGTACAGG + Intronic
1123052361 14:105551107-105551129 CACCACTCCGAAGACTGAGGTGG + Intergenic
1123125063 14:105940597-105940619 CCCCACCCCCTGGCATGAGGAGG + Intergenic
1123848230 15:24326294-24326316 CGCCACCCACATGGATGAGGAGG - Intergenic
1123984644 15:25634449-25634471 CCCTTCCCCCAAGAAAGGGGAGG + Intergenic
1123995208 15:25713437-25713459 CCCCACCTCCAAGAACTGGGGGG - Intronic
1127705929 15:61547121-61547143 CCCCATGCCCAACAATAAGGAGG + Intergenic
1128154795 15:65385545-65385567 CCCCAGCTCCAGGGATGAGGAGG + Intronic
1128557682 15:68642687-68642709 CCCCACCCCCAGGATGGAAGAGG + Intronic
1129169607 15:73799570-73799592 CCACACACCCAAGCAGGAGGTGG - Intergenic
1129206189 15:74038274-74038296 CCCCACCCCCAATATTGCTGGGG - Intronic
1129350300 15:74952109-74952131 CCCCACCACCAAGGCTGAAGTGG - Intergenic
1131056048 15:89375755-89375777 CCCACCCCCCATGAATTAGGGGG + Intergenic
1131913463 15:97234809-97234831 CCCCCCCCCCAAAAAAGAAGAGG - Intergenic
1132092624 15:98958311-98958333 CCCAACCCCCAAGAATCTGGTGG + Exonic
1133911166 16:10067869-10067891 CCCCACAGCAAAGAATGATGTGG + Intronic
1134126559 16:11620210-11620232 CCCCACCTCCAACATTGTGGAGG - Intronic
1135079658 16:19423222-19423244 CCCCACAGCCAAGAATGATCTGG - Intronic
1136268471 16:29134182-29134204 CCCAACTCCCAAGATTCAGGGGG - Intergenic
1136364864 16:29805389-29805411 CCGCAGCCCCAAAAATCAGGCGG - Intergenic
1137354658 16:47749046-47749068 CCCACCCCCCAAGAAAAAGGAGG + Intergenic
1138118403 16:54378750-54378772 CCCCAAACCCTACAATGAGGAGG - Intergenic
1138233110 16:55354442-55354464 CCCCCCCACCAAGGATAAGGAGG + Intergenic
1139658850 16:68406397-68406419 CCCCATCCCCAAGGAAGAGGAGG - Intronic
1139936119 16:70572428-70572450 CCCCACCCCCAGGTCTGTGGTGG + Exonic
1140267812 16:73435509-73435531 CCCCACCACAAAGAATGAATTGG - Intergenic
1140481151 16:75263580-75263602 CCCCTCCCCCAACACTCAGGGGG + Intronic
1140759267 16:78096754-78096776 CCCCACCACAAAGAATGATCTGG + Intergenic
1141102201 16:81206051-81206073 CCCCCCCCCCAAAAAAAAGGTGG + Intergenic
1142956043 17:3523006-3523028 CATCTCCCCCAAGAATAAGGGGG + Intronic
1143373913 17:6456313-6456335 CCCCACCCTCAAGAATCCAGAGG - Intronic
1143794261 17:9323911-9323933 CCCTGATCCCAAGAATGAGGTGG + Intronic
1144629758 17:16865078-16865100 CTCCTCTCCCAAGCATGAGGAGG - Intergenic
1144651671 17:17011039-17011061 CTCCTCTCCCAAGCATGAGGAGG + Intergenic
1145792999 17:27639354-27639376 CCCCACCCCCCAGCACCAGGAGG + Intronic
1146538792 17:33676830-33676852 CCCCACCCCCAACAATGGGAGGG - Intronic
1147341624 17:39755967-39755989 CCCCTTCCCCAGGAGTGAGGGGG - Intergenic
1147919102 17:43905700-43905722 CCCCACCCCCAGGACTCAGCAGG - Intronic
1147968579 17:44207358-44207380 TCTCACCCCCCAGAATGAAGAGG - Exonic
1148002819 17:44399833-44399855 CCGCACCACCAAGAAGAAGGCGG - Exonic
1148601266 17:48895810-48895832 CCCCAGCACCAAGAATGGTGTGG - Exonic
1148756856 17:49977713-49977735 CTCCACCCCCAAATCTGAGGTGG + Intergenic
1152042617 17:77914379-77914401 CCCCACCCCCAAGTGTCATGTGG - Intergenic
1152533012 17:80931485-80931507 CCTCACCCAGAAGATTGAGGTGG + Intronic
1152744871 17:82033994-82034016 AGCCACACCCCAGAATGAGGCGG - Exonic
1154056124 18:11014874-11014896 CCCCACACTGAGGAATGAGGGGG - Intronic
1154056160 18:11014987-11015009 CCCCACACTGAGGAATGAGGGGG - Intronic
1154056175 18:11015044-11015066 CCCCACACTGAGGAATGAGGGGG - Intronic
1154056207 18:11015157-11015179 CCCCACACTGAGGAATGAGGGGG - Intronic
1154056225 18:11015215-11015237 CCCCACACTGAGGAATGAGGGGG - Intronic
1154162698 18:11991708-11991730 ACCCTCCCCCAAGTAAGAGGGGG - Intronic
1156361874 18:36390830-36390852 CCCCACCCCCAAGAGTCTGACGG - Intronic
1159365746 18:67464161-67464183 CCACACCCCCAGGACTGAGCAGG - Intergenic
1160996233 19:1883343-1883365 ACCCACCCCAAAGAATGATCAGG + Intronic
1161108055 19:2454460-2454482 CCCCACACACAAGTAAGAGGTGG + Intronic
1161134581 19:2612230-2612252 CCCCACCCCAGAGAAGGATGGGG - Intronic
1161141989 19:2653604-2653626 CCCCACCCCAGAGAATGATCCGG - Intronic
1161633700 19:5373604-5373626 GGCCACACTCAAGAATGAGGTGG - Intergenic
1161875530 19:6905687-6905709 CCCTCCCCCCAAGAATAATGGGG + Intronic
1162183772 19:8888872-8888894 CCCCAGGCCCAAGAAGGATGGGG - Exonic
1162374989 19:10299686-10299708 CCCCACCTCCAAGAGTGACCCGG - Intergenic
1162799735 19:13103818-13103840 CCCCCCGCCCAGGAATGGGGTGG + Intergenic
1162966707 19:14159625-14159647 GCCCACCCCCAGGAATTAGAGGG - Intronic
1163846005 19:19638320-19638342 CATCATCCCCCAGAATGAGGCGG - Exonic
1164210445 19:23093531-23093553 CCCCACCCCCAAGAATGAGGGGG - Intronic
1164305704 19:24002821-24002843 CGCCACCTCCAAGGAGGAGGAGG + Intergenic
1164576492 19:29408263-29408285 CCCCATCCCCAGGAAAGATGAGG - Intergenic
1164972528 19:32544793-32544815 CCCCACCCACTAGAATCAAGTGG + Intergenic
1165261743 19:34624792-34624814 CCCAACACCCAAGAGTGATGGGG + Intronic
1165741563 19:38207887-38207909 CCCCAACACCAAGAGTGAGGTGG + Exonic
1166037223 19:40177582-40177604 CCACATCCCCAAGAATTTGGAGG - Intergenic
1166039264 19:40192022-40192044 CCCCTCCCCCATGGAGGAGGAGG + Exonic
1166072246 19:40394283-40394305 CCCCAGCCCCGAGGAGGAGGAGG - Exonic
1168060626 19:53890047-53890069 CCCCCTCCCCAAGTGTGAGGCGG + Intronic
1168444807 19:56402985-56403007 CCCCACCCCCAACCCTAAGGAGG + Intronic
929033191 2:37667798-37667820 CCACACCCCCACCAATGGGGAGG - Intronic
929938795 2:46314852-46314874 CACCACCCTCAAGAAGGAGGTGG + Intronic
931739395 2:65228161-65228183 CCCCACCCGGAAGGGTGAGGGGG - Intronic
931777933 2:65556171-65556193 CCCCACCCCCGGGAGTGAGCTGG - Intergenic
934843411 2:97645945-97645967 GCCCACTCCCAAGACTGTGGCGG - Intergenic
935256112 2:101310980-101311002 CCCCCCACCAAAGAGTGAGGGGG - Intergenic
937917283 2:127105495-127105517 CCCCACCCCAGGGAAGGAGGAGG - Intronic
939184339 2:138842648-138842670 ACCCACCCCCAACATTGAGCTGG + Intergenic
942391657 2:175501831-175501853 CCCCAAGCCCAAGAATGCTGTGG + Intergenic
943491993 2:188566158-188566180 CCCCACCTCCAAAAATGTGATGG + Intronic
943798555 2:192029147-192029169 CCCAACCCCTAAGAAAGAGATGG - Intronic
945245285 2:207711807-207711829 CCCCTCCCCCAACAATGGCGCGG - Exonic
945456886 2:210060973-210060995 CCCCACCCCCAATATGGAGGAGG + Intronic
946621743 2:221570318-221570340 CCCCCCCCCAAAAAAAGAGGGGG + Intronic
948384750 2:237574598-237574620 CCCAACCCCCCAGAAGCAGGTGG + Exonic
948421724 2:237864164-237864186 CCCCACCCCCTGGAGTGAGCTGG - Intronic
948476931 2:238226484-238226506 GCCCACCCCCGAGAGTGGGGAGG + Intronic
948870590 2:240795964-240795986 CCCCACATGCAAGACTGAGGTGG + Intronic
1172673116 20:36648006-36648028 CCCCACTCCAGAGGATGAGGTGG - Intergenic
1173349080 20:42227907-42227929 ATCCACCTTCAAGAATGAGGGGG - Intronic
1174658364 20:52190880-52190902 CCCCACCCCCGAGATTGAATGGG + Intronic
1175137179 20:56832982-56833004 CCCCAGCTCCAGGAAGGAGGAGG + Intergenic
1175490027 20:59373939-59373961 CCCAACCCCCAAGGAGGAGGAGG - Intergenic
1176083634 20:63286105-63286127 CCTCCCCCCCAAGCATGTGGTGG + Intronic
1176697098 21:9991342-9991364 CCCCACTCCCAAGAAGGGAGAGG - Intergenic
1179873214 21:44254207-44254229 CTCCACCCTCTAAAATGAGGAGG - Intronic
1180944190 22:19680638-19680660 CCCCACCCCCAGCAGGGAGGGGG - Intergenic
1181082195 22:20423218-20423240 GCCCACCCCCCAGAACGATGAGG - Intergenic
1182098006 22:27638886-27638908 CCCCACCCACAGGCCTGAGGAGG + Intergenic
1182320997 22:29478654-29478676 CCCCACGCCCAACAAAGAGCAGG + Intergenic
1183507939 22:38219845-38219867 CCGCCCCCCCAAGATGGAGGGGG + Exonic
950482978 3:13256010-13256032 CCCCACCACAAAGAGTGAAGTGG + Intergenic
950662898 3:14477657-14477679 CCCCACCCCCAGGCCTGAGAAGG - Intronic
953578184 3:44129830-44129852 CCCCACCCCCAAGCCTGATTTGG + Intergenic
953725040 3:45390082-45390104 CCCCACCCCCCAAAAAAAGGTGG + Intronic
953819396 3:46191700-46191722 CCCCACTCCCATGAGTGAGTGGG - Intronic
954639893 3:52091569-52091591 CCCCAACCCCGGGAAGGAGGAGG - Intronic
954677646 3:52324571-52324593 CCCCACCCCCAGGAAAGACCTGG + Intronic
954680729 3:52344607-52344629 CACCCTCCCCAAGAAGGAGGAGG + Exonic
954952259 3:54485908-54485930 GCCCACCCTCATGAATGAAGGGG - Intronic
955344718 3:58152594-58152616 CCCTACCCCCAACAATGTGATGG - Intronic
957114806 3:76011428-76011450 CCTCACCCCCAAAATTGAAGTGG + Intronic
959548060 3:107620994-107621016 CCACAACCCCAATACTGAGGGGG - Intronic
959752397 3:109854292-109854314 CCCTAACCCCAACAATGTGGTGG + Intergenic
959815045 3:110665307-110665329 CCCCACCACCAATAGTCAGGTGG + Intergenic
959981650 3:112524338-112524360 CACCACCCCCAGGAATGGTGTGG - Intergenic
960014759 3:112874321-112874343 TCCCACTTCCAATAATGAGGTGG - Intergenic
961965771 3:130901255-130901277 CCCCACCCCAGAGAAAGATGTGG + Intronic
962674942 3:137748911-137748933 CCTCACCACCTAGTATGAGGAGG + Intergenic
963798911 3:149658053-149658075 TCCCACCCCCAGGAAAGAGGCGG + Intronic
966749778 3:183310831-183310853 CCCCATACCAAAGAGTGAGGAGG + Intronic
966920877 3:184610645-184610667 CCCAACCCCCAAGAACTAGGGGG - Intronic
968007792 3:195254907-195254929 CCCCACCTCCCAGAAAGATGAGG + Intronic
968081206 3:195847883-195847905 CCCCACCCCCAGGAAGGGTGTGG - Intergenic
968640594 4:1712570-1712592 CCCCACCCGCGGGATTGAGGCGG + Intergenic
968658216 4:1787683-1787705 CCCCACCCCCACAAATGGGTTGG - Intergenic
968747890 4:2370436-2370458 CCCTACCCCCAAGTGTGAGCTGG - Intronic
969332966 4:6490634-6490656 CCACATCCCCTAGAGTGAGGTGG + Intronic
969876481 4:10139357-10139379 TCCCACCCCCAGGATTGACGAGG - Intergenic
974082893 4:57231086-57231108 CCCCACCCCCAAACAGGAGAGGG + Intergenic
974402382 4:61424342-61424364 CTCCACCCCCTAGGCTGAGGGGG + Intronic
977919960 4:102632098-102632120 GCCCACCAGCAAGAATGAGTTGG - Exonic
978491150 4:109313617-109313639 CCCAACACCCAAGGATGAAGGGG - Intergenic
980369704 4:131851535-131851557 CCCCACTCCCAAGAAGGGAGAGG - Intergenic
982399808 4:154954132-154954154 CCCAACCCCCAAGAGTGATGAGG + Intergenic
984952953 4:185020049-185020071 CCCCACCCGGGAGAAGGAGGTGG - Intronic
985362069 4:189186093-189186115 CCCTAGCCCCAAGAAGGAAGGGG - Intergenic
985886590 5:2684830-2684852 CCCCACCCCCATGAGTGTTGGGG - Intergenic
987942312 5:24555526-24555548 CATCACCCCCATGAACGAGGGGG - Intronic
988020093 5:25610360-25610382 CCCAACACCCAAGAGTGATGGGG + Intergenic
988468275 5:31512212-31512234 CGCCACTCCCAACAATGAGATGG - Intronic
993425921 5:87764127-87764149 CCCCACCCCCAAGGATTAGGAGG - Intergenic
995758869 5:115543816-115543838 CCCCACCCCCAAAGAAAAGGTGG + Intronic
996930590 5:128881843-128881865 CTCCACCCCCATGATTGATGTGG - Intronic
997367577 5:133335669-133335691 CACCCCCCCCAAGAAAGGGGAGG - Intronic
1000111969 5:158116842-158116864 CCCAACCCCCAAGCAAGAAGAGG + Intergenic
1001784399 5:174399587-174399609 CACAACCCCCAAGCATCAGGAGG + Intergenic
1001894195 5:175364377-175364399 CTCCACCCCCTAGGCTGAGGAGG - Intergenic
1003794201 6:9581686-9581708 TTCCACCACCAAGAATGAGGAGG + Intergenic
1003962634 6:11223115-11223137 CCCCACCACAAAGAATGACCTGG + Intronic
1004321395 6:14634212-14634234 CCCCACCCCCCCGACTCAGGTGG - Intergenic
1005108763 6:22254323-22254345 CCTCAACCCCAGGAATGAGCAGG + Intergenic
1005609999 6:27514637-27514659 CCCCACCACAAAGAATGACCTGG + Intergenic
1006604127 6:35244078-35244100 CCTCACCACCAAGCATGAAGGGG + Exonic
1006830390 6:36964598-36964620 TCCCACCCCCAGGACTCAGGAGG - Exonic
1007164108 6:39816394-39816416 CCCCACAACCAAGAATTATGTGG - Intronic
1007367614 6:41406054-41406076 CCCCAACTCCAAGAAAGGGGGGG + Intergenic
1007631991 6:43277670-43277692 CCCCACACCCAGGAATGCCGGGG - Intronic
1008608817 6:53167064-53167086 CCCCACCCCCATAAAAGAGAAGG + Intergenic
1015192218 6:130484136-130484158 GCCAATCCCCAAGAATCAGGGGG - Intergenic
1015736277 6:136403138-136403160 CCCCACCCTAATGGATGAGGAGG + Intronic
1016521623 6:144952867-144952889 CCCCACTCCCTTGAGTGAGGGGG - Intergenic
1016934021 6:149435825-149435847 GCCCACGCCCAGGAGTGAGGAGG - Intergenic
1017825330 6:158077377-158077399 CCCCACCCAGAAAAAAGAGGTGG - Intronic
1018731811 6:166657063-166657085 CCCCACCCCCAACACAGAGACGG + Intronic
1019474946 7:1240064-1240086 CCCCACACCCAAGCATGGGGGGG - Intergenic
1019552870 7:1611961-1611983 CCCCACCCCCCAGGAGGAAGAGG - Intergenic
1019831639 7:3336447-3336469 CCCCACCAGCCACAATGAGGTGG + Intronic
1021943895 7:25706341-25706363 CCCCAACCCCAACACTGAGTTGG - Intergenic
1022537643 7:31107731-31107753 CCCCACTCCCATGGATGATGAGG + Exonic
1022573906 7:31479584-31479606 CCCCACCCCCAAATATGTTGGGG + Intergenic
1023375590 7:39552210-39552232 CTCCACTCCCCAGAATGAGGTGG - Intergenic
1023842260 7:44104282-44104304 CCCCACCCCCGGGGAGGAGGAGG - Intergenic
1025139409 7:56449849-56449871 CCCCACCCTCAAGCAGCAGGTGG - Intergenic
1027200659 7:76062065-76062087 CCCCACCTCCAACAGTGAAGTGG + Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1029874269 7:103732362-103732384 CCCCACCACCAATAATTATGGGG - Intronic
1030086144 7:105817577-105817599 CCCTACCCCCAAGAAACAGAAGG + Intronic
1031972727 7:128075805-128075827 CTCCTCCTCCCAGAATGAGGGGG + Intronic
1034469262 7:151246922-151246944 CCTCACCCCCAGGCATGAGGAGG + Intronic
1035741537 8:1931595-1931617 CCTCACCACCAAGAACGAAGTGG - Intronic
1038265378 8:26035547-26035569 CCACACACCCATGAAAGAGGTGG - Intronic
1039539841 8:38356321-38356343 CCCCACCACCATGAATAAGTTGG - Intronic
1039998570 8:42557080-42557102 CCCCACCCCCAACTATTTGGGGG + Intergenic
1041274408 8:56142474-56142496 CCCAACCCCCATGATTCAGGTGG - Intergenic
1041625082 8:60016148-60016170 CCCAACCCCCATGAATGATATGG + Intergenic
1043032836 8:75159551-75159573 CCCCACACCCTTTAATGAGGAGG + Intergenic
1043781252 8:84338519-84338541 TCCCTCCCCAAAGAATGAGTTGG - Intronic
1043998788 8:86852598-86852620 CCCCAGCTCCATGAATTAGGGGG - Intergenic
1044708410 8:95031077-95031099 CCCCACCTCCAACATTGTGGGGG + Intronic
1048859038 8:138709964-138709986 CCCCACCCCCATGAAGGAGTGGG + Intronic
1049155972 8:141067124-141067146 CCCCATCCACAGGAAGGAGGGGG + Intergenic
1049930766 9:454475-454497 ACCTATCCCCGAGAATGAGGAGG + Intronic
1051313003 9:15796749-15796771 CCCCAACCCCAGGGCTGAGGAGG - Intronic
1051367114 9:16329045-16329067 GCCCCACCCCAAGAATCAGGAGG - Intergenic
1051419093 9:16872001-16872023 CCCCGGCCGCAAGAATGGGGCGG + Intergenic
1052358983 9:27534092-27534114 CCCAACCCCCAAGAAGGAGATGG + Intergenic
1053349678 9:37404912-37404934 CCCCACCCCCATGAATAATGGGG + Intergenic
1053379525 9:37636900-37636922 CCTCACCACCAAGAAGGTGGTGG - Intronic
1053634086 9:39977195-39977217 CCCCACTCCCAAGAAGGGAGAGG - Intergenic
1054209801 9:62273502-62273524 CCCCACTCCCAAGAAGGGAGAGG + Intergenic
1054315193 9:63575452-63575474 CCCCACTCCCAAGAAGGGAGAGG - Intergenic
1055530263 9:77177218-77177240 CCCCTCCCCCTAGAAGGTGGTGG - Intergenic
1057141179 9:92727649-92727671 CCCCATCACCAAGATGGAGGTGG - Intronic
1057948865 9:99353768-99353790 CCCCTCCCCCAAGAGAAAGGAGG - Intergenic
1058886374 9:109324445-109324467 CCCAACCCCCAAGGAGTAGGAGG + Intergenic
1058945829 9:109855069-109855091 CCCCACCCCAAAAAAAGGGGGGG - Intronic
1059286185 9:113173626-113173648 CCCCACCCCCAAGGATGATATGG - Intronic
1061243296 9:129386864-129386886 CCCCACCTCCCAGAGGGAGGGGG + Intergenic
1061679977 9:132238192-132238214 CACCATCCCTAAGAATGGGGGGG - Intronic
1062488878 9:136794805-136794827 CCTGGCCCCCAAGAACGAGGGGG + Intronic
1187978898 X:24733628-24733650 CCCAACCCTAAAGAATTAGGAGG - Intronic
1189337447 X:40178737-40178759 CCCCACCCCCAAAAAAGAGGTGG - Intergenic
1189377713 X:40478676-40478698 CCCCTCCCCCAACCCTGAGGAGG - Intergenic
1189427011 X:40910714-40910736 CCCCACCTCCAACACTGGGGGGG + Intergenic
1189996314 X:46642170-46642192 CCCCAACCCCAAGGATGACTGGG + Intronic
1190326508 X:49210097-49210119 CCCCCCACCCAACAGTGAGGGGG - Intronic
1190874550 X:54450291-54450313 CCCCACCCCAAGGACTGAGGAGG - Exonic
1191607357 X:63077425-63077447 CCCCACCCCCAGGAATGTCAGGG + Intergenic
1191706193 X:64096990-64097012 TCCCCTCCCCAAGAATCAGGAGG + Intergenic
1191878622 X:65822323-65822345 CCCCTCCCCCAACAATGGCGCGG + Intergenic
1193902551 X:87200139-87200161 CCTCATCCCCCAGAAGGAGGTGG - Intergenic
1194833735 X:98657283-98657305 CCAAACCCCCTAGAATGAAGGGG + Intergenic
1197041744 X:121944416-121944438 TCCCTCCCCCAAGAATAAGCAGG - Intergenic
1197537054 X:127703058-127703080 CAAAACCCTCAAGAATGAGGAGG + Intergenic
1201321240 Y:12700456-12700478 CCCTAACCCCAAGAGTGATGGGG + Intergenic
1201893357 Y:18967385-18967407 TCCCATCCTCAAGAGTGAGGAGG - Intergenic
1201980293 Y:19899902-19899924 CCCCAAGCCCAAGAATGCTGTGG - Intergenic