ID: 1164212606

View in Genome Browser
Species Human (GRCh38)
Location 19:23112892-23112914
Sequence ATGCCCATTTAGAAAAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 1, 2: 5, 3: 42, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164212606_1164212609 4 Left 1164212606 19:23112892-23112914 CCATTACTTTTCTAAATGGGCAT 0: 1
1: 1
2: 5
3: 42
4: 289
Right 1164212609 19:23112919-23112941 TGATAGGTCTTTTTTCCCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 162
1164212606_1164212615 26 Left 1164212606 19:23112892-23112914 CCATTACTTTTCTAAATGGGCAT 0: 1
1: 1
2: 5
3: 42
4: 289
Right 1164212615 19:23112941-23112963 GTTTAGAGTAAATGAGGCAATGG 0: 5
1: 1
2: 4
3: 23
4: 230
1164212606_1164212612 20 Left 1164212606 19:23112892-23112914 CCATTACTTTTCTAAATGGGCAT 0: 1
1: 1
2: 5
3: 42
4: 289
Right 1164212612 19:23112935-23112957 CCCCTGGTTTAGAGTAAATGAGG 0: 1
1: 4
2: 1
3: 25
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164212606 Original CRISPR ATGCCCATTTAGAAAAGTAA TGG (reversed) Intronic
900233652 1:1575608-1575630 TTGCGCATTCAGGAAAGTAATGG + Intergenic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
905503615 1:38459027-38459049 TTGCCCCTCTAGGAAAGTAAAGG - Intergenic
905679574 1:39858945-39858967 ATGCACATTAAGAAAACTAAAGG + Intronic
906506259 1:46382144-46382166 CAGCCCCCTTAGAAAAGTAAAGG + Intergenic
907877044 1:58501228-58501250 ATTCACATTTAAAAAAGCAAAGG + Intronic
909817798 1:80018360-80018382 ATGGCTATTTAGGATAGTAAAGG - Intergenic
909823983 1:80102171-80102193 ATGCCCCCTGAAAAAAGTAAAGG + Intergenic
909936023 1:81551849-81551871 ATGTCCATTTGGAAAACTTATGG + Intronic
910019210 1:82565987-82566009 GTACCTACTTAGAAAAGTAAAGG + Intergenic
910040332 1:82843889-82843911 ATCCCCAAAGAGAAAAGTAACGG + Intergenic
910062388 1:83109617-83109639 ATTTCCATCTAGACAAGTAAAGG - Intergenic
910549863 1:88463282-88463304 ATGCCTATTCAGAAAAGAACAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
912214529 1:107592901-107592923 ATGACCATTTTGGAAAATAATGG + Intronic
912278612 1:108288667-108288689 ATGCCCATTGAGTATAATAATGG - Intergenic
912283637 1:108344832-108344854 ATGTTGATTTGGAAAAGTAAAGG + Intergenic
912289614 1:108405690-108405712 ATGCCCATTGAGTATAATAATGG + Intronic
913427053 1:118744794-118744816 ATAACCTTGTAGAAAAGTAAAGG - Intergenic
913578632 1:120203556-120203578 ATGGCCTTAGAGAAAAGTAAGGG + Intergenic
913629541 1:120694797-120694819 ATGGCCTTAGAGAAAAGTAAGGG - Intergenic
914560561 1:148814995-148815017 ATGGCCTTAGAGAAAAGTAAGGG + Intronic
914612273 1:149315224-149315246 ATGGCCTTAGAGAAAAGTAAGGG - Intergenic
917111875 1:171557124-171557146 GTACCTATTTTGAAAAGTAAAGG + Intronic
918520329 1:185407814-185407836 ATGCCCATTTAGAGATGGGACGG - Intergenic
920105538 1:203550545-203550567 TTGCCCAGGTAGGAAAGTAAGGG - Intergenic
920743459 1:208603090-208603112 ATGCCCATTTTGGAAGGCAATGG + Intergenic
920759336 1:208767172-208767194 AGGACCATTGAGAAAAATAAAGG + Intergenic
921093673 1:211868253-211868275 ATACGCCTTTAGTAAAGTAATGG + Intergenic
922065292 1:222131754-222131776 ATGCCCAATTAAAAAAGTTTTGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
923074517 1:230597861-230597883 ATGCCACTTTAGAGAATTAAGGG - Intergenic
924151155 1:241131242-241131264 ATGACAATTTAGAAATGTAAGGG + Intronic
924557264 1:245128945-245128967 AAGCGCATTTAGAAAAGCAGAGG + Intergenic
1062943455 10:1441753-1441775 ATGTCAATTTTGAAAATTAAAGG - Intronic
1063579931 10:7297105-7297127 CTGAACCTTTAGAAAAGTAACGG - Intronic
1066052996 10:31653326-31653348 ATGGCAATTTAGAAATATAAAGG + Intergenic
1066273611 10:33846994-33847016 ATGCCAATCTACAAAAGCAATGG - Intergenic
1066784183 10:38984065-38984087 ATACTCATGTACAAAAGTAAAGG - Intergenic
1069027183 10:63555331-63555353 ATTCCCATTTAGTAAAACAATGG - Intronic
1069634959 10:69919453-69919475 ATGCACATTTAGCAAATTAAAGG - Intronic
1072478735 10:95789204-95789226 AAACTCATTTAGAAAAGTCAAGG - Intronic
1073841828 10:107506586-107506608 AGGCCCCTGTGGAAAAGTAATGG + Intergenic
1075809742 10:125216319-125216341 AGACCCATTTGGAAAAGTTAGGG - Intergenic
1076449424 10:130546249-130546271 ATGCCCATAGAGAATGGTAAAGG - Intergenic
1079853997 11:25577332-25577354 ATGAAGATTTACAAAAGTAATGG + Intergenic
1080169624 11:29284008-29284030 ATGCACATGTGAAAAAGTAAGGG + Intergenic
1081211616 11:40342165-40342187 TTAATCATTTAGAAAAGTAAAGG + Intronic
1081635943 11:44722289-44722311 ATTCCCATTTAGAAATGCATGGG + Intergenic
1082079616 11:48002091-48002113 TTGCCCATTTAAAAAATTTAAGG - Intronic
1082854069 11:57790856-57790878 ATGCCAATTAAGAAATGAAAAGG - Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086178915 11:83926262-83926284 ATCCACATTTAGAAGAATAAAGG - Intronic
1087443367 11:98214349-98214371 CTGCCCATGTGGAAAAGTAATGG + Intergenic
1087558152 11:99748798-99748820 ATGCCCATTTACACTGGTAAAGG + Intronic
1087746865 11:101957507-101957529 ATGGCCCTTTAGCATAGTAAAGG + Intronic
1088060367 11:105642251-105642273 TTGCATATTTAGAAAAGGAAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088283655 11:108163552-108163574 ATGTACATTTCCAAAAGTAAAGG + Intronic
1088577371 11:111284911-111284933 ATGCTCATAGAGAATAGTAAAGG + Intronic
1089455180 11:118621700-118621722 ATCCCCATTTAGAAATGTTCAGG - Intronic
1089909028 11:122076886-122076908 ATGCCCATTCACAAAAGCATGGG - Intergenic
1093367660 12:18323498-18323520 ATACCCTTTGAGAAAAATAAGGG - Intronic
1093370641 12:18360934-18360956 ATGCTCATTTGAAAAAGTAATGG - Intronic
1094075645 12:26470669-26470691 ATGACCATTTAAAAAAATATTGG - Intronic
1094178517 12:27566494-27566516 AACCCCATTTAGAATAGTGATGG + Intronic
1094252206 12:28375747-28375769 AAGCCCAATTAAACAAGTAAAGG - Intronic
1097481259 12:60128618-60128640 ATACACGTTTACAAAAGTAATGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098322662 12:69262062-69262084 ATGCACAAATAGAAAGGTAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100752383 12:97712972-97712994 AAGCTCATTCAGAAAAATAAAGG - Intergenic
1100991828 12:100259688-100259710 TTTCCCTTTTAGAAAATTAATGG + Intronic
1101071900 12:101084473-101084495 ATGTCATTTTAGAACAGTAAAGG + Intronic
1102401549 12:112634041-112634063 ATGCCAATTTAAAAAATAAATGG + Intronic
1102666230 12:114575732-114575754 ATGCTCAGATAGAAAAGGAATGG + Intergenic
1102817651 12:115880650-115880672 ATGCAAATTCAGAAAAATAATGG + Intergenic
1107745832 13:43507242-43507264 ATTCCCAGTAAGAAAAGCAAAGG + Intronic
1107950739 13:45459313-45459335 TTGGCCATTTAGAAAAGTCCTGG - Intergenic
1108527868 13:51301070-51301092 AAGTCTATTAAGAAAAGTAACGG - Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1112243969 13:97711491-97711513 CTTCCCATTTAAAAAAGCAATGG + Intergenic
1112431986 13:99358307-99358329 ATACACAGTTAGAAAAGAAAGGG - Intronic
1113000497 13:105630392-105630414 ATGTCCATGTACTAAAGTAAAGG - Intergenic
1113240563 13:108332113-108332135 ATGCTCAATTAGAAATGAAATGG + Intergenic
1114508911 14:23240064-23240086 ACACACATTTAGAAAAGTAATGG - Intronic
1115373479 14:32646195-32646217 AGGACCATTTAAAAAACTAAAGG + Intronic
1116121011 14:40722515-40722537 ATGACCATTTAGAAATGTCATGG + Intergenic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1117651394 14:57909507-57909529 ATGACATTTTAGAAAAGAAAAGG - Intronic
1118708756 14:68502818-68502840 ATCCTCATTTAGAAAAGGACAGG + Intronic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1120348881 14:83327270-83327292 ATCCCCATTTTGAAAATGAAGGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121972081 14:98367506-98367528 ATATCCATTTCGATAAGTAATGG - Intergenic
1122548471 14:102537836-102537858 ATCCCCATTTACAGAAGTAGTGG - Intergenic
1123478419 15:20609636-20609658 TTTCCCGTTTTGAAAAGTAAAGG + Intergenic
1123639595 15:22390749-22390771 TTTCCCGTTTTGAAAAGTAAAGG - Intergenic
1125035470 15:35119055-35119077 ATGCCAATTTATAAAATGAAAGG - Intergenic
1125707838 15:41756234-41756256 ATGACCCAGTAGAAAAGTAATGG + Intronic
1125780133 15:42258285-42258307 ATGCCCATATACAAAAGAATAGG + Intronic
1126269215 15:46793231-46793253 TTGTCCATTTAGGAAAGTCATGG - Intergenic
1127511666 15:59648059-59648081 ATGCCCATAGATAAAAGTAATGG - Intronic
1127519200 15:59726676-59726698 ATGCCCATTAAGGAGAATAAAGG + Intergenic
1127721891 15:61710294-61710316 ATGCCCAATTAGAAAGAAAAAGG + Intergenic
1128189528 15:65678531-65678553 ATAGCCAGTTAGAAAAGTAATGG - Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1129304856 15:74652542-74652564 ATTCACATTTAGAAGAGAAAAGG + Intronic
1130431613 15:83853232-83853254 ATAATCATTTAGAAAAATAATGG - Intronic
1130741335 15:86603531-86603553 ATGCCCATCTAGAAAGTAAAAGG - Intronic
1131787345 15:95927229-95927251 AAGCCCATTTAGAAAAGCTCTGG - Intergenic
1132132605 15:99296930-99296952 ATACCCATTTTGACAACTAATGG + Intronic
1132177552 15:99727431-99727453 ATTCCATTTGAGAAAAGTAAAGG + Exonic
1132290702 15:100701140-100701162 ATCACCATTTAGAACTGTAATGG - Intergenic
1132412639 15:101595393-101595415 AAGCCCAATTAGAAATATAAGGG - Intergenic
1133579893 16:7133843-7133865 ATGCCCATTTTGAAATATCATGG + Intronic
1136706863 16:32197871-32197893 ATTCACATTTAGTAAAGGAAGGG + Intergenic
1136761048 16:32731546-32731568 ATTCACATTTAGTAAAGGAAGGG - Intergenic
1136807055 16:33138840-33138862 ATTCACATTTAGTAAAGGAAGGG + Intergenic
1137040235 16:35604327-35604349 GTGCCCATTCAGAAAAGTCAAGG + Intergenic
1139108130 16:63853669-63853691 AGGAAGATTTAGAAAAGTAATGG + Intergenic
1140751958 16:78032950-78032972 AAGCCCATTCAGAAAGGCAATGG + Intronic
1203063200 16_KI270728v1_random:991863-991885 ATTCACATTTAGTAAAGGAAGGG - Intergenic
1142735308 17:1894621-1894643 TTGCCTATTTAAAAAAGTACTGG - Intronic
1143461036 17:7103609-7103631 GTGCCCATTCACAAAAGTAATGG + Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1146785580 17:35718022-35718044 ATCTGCATTTTGAAAAGTAAAGG + Intronic
1146984541 17:37202825-37202847 AAGGCTATTTAGAAAGGTAAGGG - Intronic
1147112804 17:38276276-38276298 TTGCTCATTTAGTAAAGTGAGGG - Intergenic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1148416815 17:47512967-47512989 TTGCTCATTTAGTAAAGTGAGGG + Intergenic
1151077833 17:71294647-71294669 ATGCCCAATTAGCAAATAAATGG + Intergenic
1151410034 17:73918383-73918405 AAATTCATTTAGAAAAGTAAAGG + Intergenic
1154222005 18:12463987-12464009 ATTCCCATTTTGAAAACAAAAGG + Intronic
1156239535 18:35240007-35240029 TTTCCCATTTAAAAAATTAAGGG - Intergenic
1159204708 18:65234247-65234269 ATGCCCAGCTACAAAATTAAAGG + Intergenic
1159680837 18:71350101-71350123 ATGCACATTTAGAAATGTTTTGG - Intergenic
1163982790 19:20916987-20917009 ATGACCACTCAGAAGAGTAATGG - Intergenic
1164042091 19:21502033-21502055 ATACCCATTCAGAAGAGTAATGG - Intronic
1164071402 19:21772116-21772138 ATACCCATTAAGAAGAGTACTGG + Intergenic
1164138702 19:22438094-22438116 ATGCCCATTCAGAAGAGTAATGG - Intronic
1164181948 19:22827018-22827040 ATGCCCATTCAGAAGAGTAATGG - Intergenic
1164212606 19:23112892-23112914 ATGCCCATTTAGAAAAGTAATGG - Intronic
1164245421 19:23424237-23424259 ATGGCCATTCAGAAGAGTAAGGG - Intergenic
1164308644 19:24027300-24027322 ATGGCCATTCAGAAAAGTAAGGG + Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1166449206 19:42883432-42883454 TTGCCCATTTATAAATTTAATGG + Intronic
1168111931 19:54197484-54197506 ATGCAGATTGAAAAAAGTAAAGG + Intergenic
925241672 2:2336561-2336583 ATGCTCATTTAGAAGAGTTTTGG + Intergenic
925965379 2:9060758-9060780 ACCCCCATTTAGAAAAGGGAGGG + Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
927598524 2:24419457-24419479 CTACCCATATAGAAAAGAAATGG + Intergenic
930370727 2:50497947-50497969 ATCCTCATTAACAAAAGTAATGG + Intronic
930859204 2:56052452-56052474 ATGCCCATTTTAAAAAATGAGGG + Intergenic
931041637 2:58307126-58307148 ATGCCCATCCAGAAAAATAAAGG - Intergenic
931158788 2:59665376-59665398 CTTCCTATTTAGAAAATTAATGG - Intergenic
932973305 2:76572109-76572131 ACTGCCATTTAGCAAAGTAAGGG + Intergenic
932982991 2:76692792-76692814 ATGCTCATTCAGAAATGAAAAGG + Intergenic
933736246 2:85497068-85497090 ATGCCCATTCAGAAGGGTGAAGG - Intergenic
935484624 2:103638418-103638440 ATGACTATTTAGAGAAGGAAAGG - Intergenic
936704033 2:115049566-115049588 ATTACAATTTAGAAAAGGAATGG - Intronic
939262189 2:139824409-139824431 ATGGCCATTTAGAGAAGAATTGG + Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
943364270 2:186954522-186954544 ATGCCCATTCACAAAAGAATGGG + Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943607508 2:189993858-189993880 AAGCTCAATTAGAAATGTAATGG - Intronic
944885260 2:204056392-204056414 ATTCCCTTTGAGGAAAGTAAGGG + Intergenic
947286289 2:228519030-228519052 TTGTCCATCTAGAGAAGTAAGGG - Intergenic
947474347 2:230429519-230429541 AAGTACATTTAGAGAAGTAATGG - Intronic
948029551 2:234805811-234805833 AAGCCTAGTCAGAAAAGTAAAGG + Intergenic
1169895554 20:10501903-10501925 ATGCCTATGTAAAAATGTAATGG + Intronic
1170199922 20:13731751-13731773 ATGCACAATTAGAAAGGTGAGGG - Intronic
1171375322 20:24689745-24689767 AAGCTCATTTAGAAATGAAATGG - Intergenic
1172862947 20:38070418-38070440 AAGCCCATTCAGAAAGGCAAAGG + Intronic
1173465752 20:43279960-43279982 ATGCCCATGAGGAAAAGGAATGG + Intergenic
1177082902 21:16663740-16663762 AGGACCATTTAGAAATGTATTGG - Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1178118485 21:29442696-29442718 AAGCACTTTTAGAAAACTAAAGG - Intronic
1179056198 21:37937387-37937409 ATGCGGATTTTGAAAAGAAAGGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949496417 3:4636216-4636238 TTGTGCATTTAGAAAAGAAATGG + Intronic
949589230 3:5476043-5476065 ATACCCATGGAGGAAAGTAAAGG - Intergenic
951294743 3:20920405-20920427 AAGCTCAATTAGAAAAGAAATGG + Intergenic
952601761 3:35091874-35091896 ATGCTCAATTAGAAATGAAATGG + Intergenic
952632516 3:35486641-35486663 ATGGCCATTTTGATAATTAAAGG - Intergenic
953082160 3:39631064-39631086 ATGGCTATTTAAAAATGTAATGG - Intergenic
953084368 3:39652596-39652618 ATGGCTATTTAAAAATGTAATGG + Intergenic
954039908 3:47877570-47877592 ATGCCCATTTTGAAAATACAAGG + Intronic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
958444633 3:94200103-94200125 AAGCTCAGTTAGAAATGTAATGG - Intergenic
958537854 3:95426857-95426879 ATACCCAATAAGAAAATTAAGGG + Intergenic
958701961 3:97603040-97603062 ATTCACATTTAGAAAAGTAATGG - Intronic
960209490 3:114943155-114943177 ATGACTATTTATAAAACTAAGGG + Intronic
963928765 3:150979581-150979603 ATGCGCATCTAGAACAGTTATGG - Intergenic
964190160 3:153992198-153992220 ATGCCATTTTAAAAAGGTAACGG + Intergenic
964750954 3:160053569-160053591 ATGCCCAGTCACAAAAGGAATGG + Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965169947 3:165250120-165250142 ATGCATATTCAGAAAGGTAAAGG + Intergenic
965408125 3:168295932-168295954 ATGTCCAATTAGTAAATTAATGG + Intergenic
965728092 3:171741301-171741323 ATGCCCATGGACATAAGTAAAGG - Intronic
966686402 3:182700493-182700515 ATGCCCATTCAGAAGTGTGAAGG + Intergenic
967317411 3:188162365-188162387 ATGCTCATTTGCAAAAGTTAAGG - Intronic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
970104858 4:12570102-12570124 ATGCCCATGTAGACTTGTAAGGG + Intergenic
971041253 4:22754688-22754710 ATGCACATTTAGAAAAACACAGG - Intergenic
971660001 4:29401222-29401244 ATGCTCCTTTAGAAAATAAATGG - Intergenic
971962857 4:33511345-33511367 ATGCCCATCCAGAAGGGTAAAGG - Intergenic
972824376 4:42739763-42739785 AAGCCCAATTAGAAATGCAAAGG + Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974649357 4:64734193-64734215 ATGCCCATTTAGAATAGTAAAGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
975418495 4:74134398-74134420 ATGGCCATTTGCAAAAGTCAAGG + Intronic
975622880 4:76311640-76311662 ATGCCCATGAGGAAAATTAAAGG + Intergenic
977549583 4:98426505-98426527 AAGCTCACTTAGAAAAGAAATGG + Intronic
977804230 4:101277621-101277643 ATGTACATTTAGAGAAATAATGG - Intronic
978608888 4:110514626-110514648 ATACCTATTTAGAAAGCTAAAGG - Intronic
978757680 4:112321205-112321227 AAGCTCAATTAGAAAAGAAACGG - Intronic
978762091 4:112364352-112364374 AAGCTCAATTAGAAAAGAAATGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979044647 4:115847009-115847031 AAGCCCATTCACAAAAATAAGGG + Intergenic
980164784 4:129212719-129212741 AAGGCAATTTAGAAAAGAAATGG - Intergenic
980320596 4:131267962-131267984 GTGCCCATGAAGAAAAGAAAAGG + Intergenic
980491116 4:133531103-133531125 ATGCCTATTTAGGTAGGTAAAGG - Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981080986 4:140639043-140639065 ATGCCCATTCAAAGGAGTAAAGG - Intronic
982594434 4:157361128-157361150 AGCCCCAGTGAGAAAAGTAATGG + Intronic
983193909 4:164783556-164783578 ATTTCCATTTAGAAATGGAATGG - Intergenic
983629312 4:169833641-169833663 ATGCCCACTTAGATAACTAGTGG + Intergenic
988103951 5:26718911-26718933 ATGCCCATCTACATAAGTGAGGG - Intergenic
991207912 5:64071098-64071120 ATGTCCATTGAAGAAAGTAAGGG - Intergenic
992154046 5:73937183-73937205 ATGCCCACAAAGAAAAGGAATGG + Intronic
992194288 5:74324566-74324588 AACCCCATTTTGAAAATTAAGGG + Intergenic
994207703 5:97054029-97054051 AAGCTCAGTTAGAAAAGAAATGG - Intergenic
994453895 5:99981148-99981170 ATGCCCAGGTAGATAAGGAAGGG + Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
996805185 5:127446711-127446733 AGGCCCTTTTAGGAAAGTGAAGG + Intronic
997542477 5:134674871-134674893 ATAACCATTTAGAATAATAATGG + Intronic
999843742 5:155456155-155456177 TTTCCCATTTAGAAATGTATTGG - Intergenic
1000102312 5:158027853-158027875 ATACAGATTTAGAAAAATAATGG - Intergenic
1000841608 5:166226203-166226225 ATGACGATTTAAAAAACTAAAGG + Intergenic
1001868035 5:175122715-175122737 ATACCCAATTAAAAATGTAATGG + Intergenic
1004766534 6:18734374-18734396 ATGCCCATTAAGTAAAGACATGG - Intergenic
1005258083 6:24026056-24026078 ATAGCCATTTAGAAAAAGAATGG + Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1008869417 6:56254712-56254734 ATGACCTTTAAGAAAAGTTAAGG - Intronic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1009809651 6:68644393-68644415 ATGCCCATCTAGAAAAAAAATGG + Intronic
1009829766 6:68915045-68915067 CTGCAAATTTAGAAAAGTAAAGG + Intronic
1009856146 6:69266807-69266829 ATGCATATTCAGAAAGGTAAAGG + Intronic
1010441379 6:75898902-75898924 ATATCCATTTATAAAAGTAATGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011153247 6:84299077-84299099 GTGCCCATTCAGAAGAGTGAAGG - Intergenic
1013208303 6:107964500-107964522 ATGACCATTTACAAATGAAATGG - Intergenic
1013953448 6:115813028-115813050 ATGCCAATTTGGAAAAGAAGTGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014378498 6:120708979-120709001 ATGGCCTTTTATAAAATTAAGGG + Intergenic
1014645683 6:123969601-123969623 ATGCCTATTTTCAAAAGGAATGG + Intronic
1014897467 6:126920803-126920825 AGGCACATTTAAAAAAATAAAGG - Intergenic
1015351870 6:132229188-132229210 ATCCCCATCAAGGAAAGTAATGG + Intergenic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016365796 6:143316797-143316819 AAGCTCAATTAGAAAAGAAACGG + Intronic
1017319674 6:153075325-153075347 ATGCCCAGTTACAAAAGTGAAGG - Intronic
1019954656 7:4403843-4403865 TTTGCCATTTAGAAAAGTAATGG - Intergenic
1020650458 7:10868797-10868819 ATGCCCATCTGTAAAAGTGAGGG - Intergenic
1021597259 7:22330477-22330499 AGGGCCATTTAGAAATGGAAGGG - Intronic
1022140591 7:27489970-27489992 ATGCACACATAGAAAAGTCATGG - Intergenic
1024464442 7:49696749-49696771 ATGCAAATTTAGAAAAGTTGAGG + Intergenic
1024713093 7:52040051-52040073 ATGCCCATTTAAGATAGCAAAGG - Intergenic
1025801572 7:64791423-64791445 ATGCTTATTTAGAAGAGTAATGG - Intergenic
1025864612 7:65369271-65369293 ATGCCCATTCAGAGGAGTAATGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027757425 7:82231819-82231841 ATGCACAATTAGAAAAATAATGG + Intronic
1028101462 7:86826001-86826023 ATGCCTTTTTAAAAAAGTCATGG + Intronic
1029154908 7:98509912-98509934 ATGCCCATTAGGAAGAGGAAGGG - Intergenic
1029335875 7:99898700-99898722 TTGCCCAGTGAGAAGAGTAATGG - Intronic
1029984102 7:104905695-104905717 TTTCCCATTTAGATAAGGAATGG + Intronic
1030392920 7:108949409-108949431 TTGAACATTTAGAAAAGAAAGGG + Intergenic
1030691248 7:112536884-112536906 ATGTTCACTTAGAAAAATAAGGG - Intergenic
1030848301 7:114450570-114450592 ATGCACATTCAGAAAAGTTTCGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034247538 7:149659187-149659209 AAGCCCAATTAGAAATGGAATGG - Intergenic
1036109774 8:5885239-5885261 ATGGCTATTTAGAAAAGCAAAGG + Intergenic
1036479224 8:9123373-9123395 ATGCCGATTTATTAATGTAAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040442561 8:47459485-47459507 AAGCTCAATTAGAAAAGAAATGG - Intronic
1042962490 8:74319437-74319459 ATGCCCATTCAGAACATTTAAGG + Intronic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1043224617 8:77709571-77709593 ATGCCAATTTTGTAATGTAATGG - Intergenic
1044186882 8:89263974-89263996 ATCCCCATCTAGAAAAGTACAGG - Intergenic
1044257733 8:90085149-90085171 ATTTCCATTTAGAAATGTATAGG + Intronic
1044903590 8:96975137-96975159 ATGCTCAATTAGAAATGAAATGG + Intronic
1045410778 8:101915639-101915661 AAGCCCATTTAAAAAATTTATGG - Intronic
1047542716 8:125785767-125785789 ATGACCATTGATAAAAATAAGGG - Intergenic
1047916168 8:129586048-129586070 ATGACATTTTAGAAAAGTACTGG - Intergenic
1048076274 8:131074566-131074588 ATTCCCATTTAGAAAATCAAAGG + Intergenic
1048116567 8:131530822-131530844 ATGCCCTGTTAGAAAAGGTAGGG - Intergenic
1048583199 8:135747967-135747989 GTGCCCAATTATAAAAGTACAGG + Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050466805 9:5935285-5935307 ATGCTAATTTAGAAATATAATGG - Intronic
1052053064 9:23871045-23871067 AAGCTCAATTAGAAAAGAAATGG + Intergenic
1053230565 9:36404926-36404948 AGACCCCTTTAGAAAATTAAAGG + Intronic
1057365521 9:94417182-94417204 TTTCCCATTTAGAAAAATTATGG + Intronic
1059520278 9:114934316-114934338 AAAGCCATTTTGAAAAGTAAAGG + Intergenic
1061290086 9:129645798-129645820 ATGCCCATTTAGAAAGGAGGGGG - Intergenic
1185655466 X:1680808-1680830 ATGCACATTGAGAAAAGTTTGGG - Intergenic
1186106339 X:6211286-6211308 ATGCCCAATTTGAAAATTAGAGG + Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187439639 X:19306659-19306681 ATGTCAAATGAGAAAAGTAAAGG - Intergenic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1189732470 X:44035876-44035898 ATGGGCTTTCAGAAAAGTAAAGG - Intergenic
1192633884 X:72800358-72800380 AAGCATATTTAGAAAAATAACGG - Intronic
1192647826 X:72920443-72920465 AAGCATATTTAGAAAAATAACGG + Intronic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193015603 X:76730097-76730119 ATGCTCCATTAGAAAAGAAATGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1193528448 X:82622965-82622987 ATGCCATTTTATAAAAGGAAAGG + Intergenic
1193908007 X:87265735-87265757 ATGCACAGTAAGAGAAGTAAGGG - Intergenic
1193937397 X:87639982-87640004 AAGCCCAATTAGAAATGAAATGG + Intronic
1193939521 X:87663512-87663534 ATGCCCATGCAGAAAAGTCTTGG + Intronic
1195375245 X:104220444-104220466 ATGCCCATTTATGCAAATAAAGG + Intergenic
1196629027 X:117914200-117914222 ATTCCCATTTAGAAAAAAATGGG + Intronic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197312377 X:124920877-124920899 ATGCCCATAAACAACAGTAAGGG - Intronic
1197778744 X:130138725-130138747 ATGCCCCTTTTGGAAATTAATGG - Intronic
1197846828 X:130811609-130811631 CTGCACATTTAAAAAAGTATGGG - Intronic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic