ID: 1164214957

View in Genome Browser
Species Human (GRCh38)
Location 19:23136256-23136278
Sequence TGTAAAGTAAGATTACCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164214957_1164214959 2 Left 1164214957 19:23136256-23136278 CCCTTTGGTAATCTTACTTTACA 0: 1
1: 0
2: 0
3: 16
4: 275
Right 1164214959 19:23136281-23136303 GAGAGCCAAAGTCCATTTCATGG 0: 1
1: 3
2: 11
3: 25
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164214957 Original CRISPR TGTAAAGTAAGATTACCAAA GGG (reversed) Intronic
905779696 1:40697319-40697341 TATACAGTAAGATTTCCAAATGG + Intronic
906042295 1:42797262-42797284 TGTAAAGCAAAATCAGCAAAGGG + Intergenic
908111904 1:60906149-60906171 TGTAAAGTAAGACTAGCCATAGG + Intronic
909375880 1:74941545-74941567 ACAAAAGTAAAATTACCAAATGG - Intergenic
909751604 1:79167828-79167850 TTTAAAATAACTTTACCAAAAGG + Intergenic
911666442 1:100558061-100558083 TGTAAAGTAACATTAATACAAGG + Intergenic
911666444 1:100558096-100558118 TGTAAAGTAACATTAATACAAGG + Intergenic
916772621 1:167927033-167927055 TGTCAAGGAAGATTAAGAAAAGG - Intronic
918494301 1:185116368-185116390 AATAAAGGAAGATTACCAAGTGG + Intergenic
919100802 1:193095039-193095061 TGTAAAGTAAGACTTCCTATAGG + Intergenic
919113614 1:193252589-193252611 TGTAAAGGAACATTAGGAAAAGG + Exonic
919336475 1:196243283-196243305 GGTGAAGCAAGATGACCAAATGG + Intronic
919654486 1:200184224-200184246 AGTAAATTAAGACTGCCAAAAGG + Intergenic
922273790 1:224057895-224057917 TGGAAATGAAGATTACCAGATGG - Intergenic
1065642599 10:27800274-27800296 TGTAAACTAAAAATAACAAAAGG + Intergenic
1066695553 10:38074315-38074337 TGTAAGATGTGATTACCAAAAGG + Intergenic
1068259935 10:54566618-54566640 TGTAAATTCAAAATACCAAATGG - Intronic
1069063169 10:63915114-63915136 TTTAAAGAAACATTCCCAAATGG + Intergenic
1069762299 10:70820160-70820182 TGTAAAAGAAGGATACCAAAAGG - Intronic
1072002443 10:91209935-91209957 TGGAAATTGAGATTCCCAAATGG + Intronic
1072945568 10:99807243-99807265 TATAAAGTATGATTACAGAAAGG - Intronic
1073283786 10:102374821-102374843 TGTAAAGAAATAATACAAAAAGG - Intronic
1075059422 10:119244931-119244953 TTAAAAGTAGGATTACCACATGG + Intronic
1079568960 11:21918961-21918983 TGTAAAATATTCTTACCAAATGG + Intergenic
1079962225 11:26938906-26938928 TCTAAAGTAAGATTTTTAAATGG + Intergenic
1080025650 11:27611309-27611331 TGAAAAGAAAGATTTCCAGATGG - Intergenic
1080595515 11:33770921-33770943 TGAAAAGTAAGAGAAACAAAAGG - Intronic
1085925495 11:81015046-81015068 TGTAGAATAAGAATAACAAACGG - Intergenic
1086069757 11:82787705-82787727 TGCAAAGTAAGATTTCTAATGGG + Intergenic
1086101582 11:83105648-83105670 TGTAAAAGAAGATATCCAAATGG - Intergenic
1086605771 11:88694467-88694489 TTTAAATGAAGACTACCAAAGGG + Intronic
1087164513 11:94988168-94988190 AGTAAAGACAGATTACAAAAAGG + Intronic
1088055715 11:105574069-105574091 TGGAAAGTCAGATTAAAAAACGG + Intergenic
1089908494 11:122071198-122071220 TGAAAACTATGATTACCAAAAGG - Intergenic
1092053281 12:5488654-5488676 TTTAAAGTAGAATTACAAAAGGG - Intronic
1092504931 12:9088897-9088919 TCAAAATTAATATTACCAAAAGG - Intronic
1092753418 12:11740222-11740244 TATAAAGTAATACAACCAAAGGG + Intronic
1093557337 12:20491933-20491955 TGGGAAGTAAGATTACAACAGGG - Intronic
1093740371 12:22678964-22678986 TGTAATGTAACATTCCCAAGAGG + Intronic
1095732185 12:45518288-45518310 TGTAAAGACAGATAACAAAATGG - Intergenic
1096376636 12:51117167-51117189 TACAAAGTAAGAGTAACAAAAGG - Intronic
1096421593 12:51463275-51463297 GGTAAAGTAAGATTACACAGAGG + Intronic
1096793771 12:54061329-54061351 TGGAAAATAAGGTTACCGAATGG + Intergenic
1097796016 12:63862700-63862722 TGTAAAACAAGATGAGCAAACGG - Intronic
1098604077 12:72369039-72369061 GGGAAAGTGAGATGACCAAAGGG + Intronic
1099317292 12:81100321-81100343 TGTAAAATAAGAAGTCCAAAAGG + Intronic
1099340857 12:81432011-81432033 GGTTTAGTAATATTACCAAAGGG - Intronic
1099455501 12:82857985-82858007 GGAAAAGTAATATTAACAAATGG - Intronic
1100079113 12:90826114-90826136 TTTCAAGTAAAATTCCCAAATGG + Intergenic
1100711711 12:97264280-97264302 TGTAAATTAAGATTAAGACAAGG + Intergenic
1104486772 12:129158056-129158078 TTTAGAGAAAGATTACCATATGG + Intronic
1105840548 13:24250035-24250057 AGGAAAGAAAGATTAGCAAAAGG - Intronic
1107104515 13:36628950-36628972 TGTAAAATTAGACTAACAAAAGG + Intergenic
1107474819 13:40725736-40725758 TGTAAAGCAAGAATACAGAAAGG - Intergenic
1108785457 13:53895702-53895724 TGTAAATTAAGACAACCATATGG + Intergenic
1109474919 13:62867633-62867655 TTTATAGAAAAATTACCAAATGG - Intergenic
1113302944 13:109042727-109042749 TGTTAAATAATATTACCTAAGGG - Intronic
1114068549 14:19088502-19088524 TGTAAAGCAAGATCACAAAGAGG + Intergenic
1114093715 14:19311512-19311534 TGTAAAGCAAGATCACAAAGAGG - Intergenic
1115064848 14:29245346-29245368 TGTAAAGAAAGAAGAGCAAATGG + Intergenic
1115811205 14:37109849-37109871 TATAAAGTAAGATTTAAAAAGGG + Intronic
1116655552 14:47649420-47649442 TGTAAAATTGGATGACCAAAAGG - Intronic
1117601905 14:57384903-57384925 TTCAAGGTAAGATCACCAAAAGG + Intergenic
1118795016 14:69134649-69134671 TCTAAAGGAAGACTACAAAATGG + Intronic
1118813585 14:69292888-69292910 TGTAGAGGAAGGTTAACAAAAGG - Intronic
1119882495 14:78111945-78111967 TGTAAATTAAAATGACTAAAAGG - Intergenic
1119954693 14:78784404-78784426 TGTAAAGTAAGGTCACCAGGTGG + Intronic
1120078120 14:80183195-80183217 AGTAGAGTAACATTTCCAAAGGG + Intergenic
1120187123 14:81405291-81405313 TGTAAAATAACATTATAAAATGG - Intronic
1120746755 14:88159257-88159279 TGTAAACAAAGTTCACCAAAGGG - Intergenic
1121806747 14:96833580-96833602 TGGAAAGTAGGATTACCCATTGG + Exonic
1124114158 15:26824596-26824618 TGGAAAGTAATATTACAAACTGG + Intronic
1124566954 15:30824822-30824844 TGTATTGTGAAATTACCAAATGG + Intergenic
1126793617 15:52242688-52242710 TGTACAGAAAGACTAACAAATGG + Intronic
1127200567 15:56645249-56645271 TGGAAAGTATAATTACCTAATGG - Intronic
1129992664 15:79978331-79978353 AGTAAAGTCAGATTCCCAGAGGG - Intergenic
1130636321 15:85624063-85624085 TGTAAAATTAGTGTACCAAAAGG + Intronic
1130756635 15:86771286-86771308 TGTATTGCAAGATTATCAAAAGG - Intronic
1130835041 15:87641803-87641825 TGTAAAAAAAAATTTCCAAAAGG - Intergenic
1131721869 15:95178223-95178245 TGTAAACTAATATTACCAATGGG - Intergenic
1133507346 16:6425119-6425141 TGAAAAATAATATTACTAAAAGG - Intronic
1135340818 16:21646511-21646533 TGTAAAGTACCATGTCCAAAGGG - Intronic
1135785663 16:25346920-25346942 TGTAAGGTAAATTTACCTAATGG - Intergenic
1138005301 16:53329778-53329800 TGCAAAGAAAAATTACCCAAAGG - Intergenic
1139736608 16:68995249-68995271 TGTAAGGTAATATAACCAAGAGG - Intronic
1144310815 17:14012800-14012822 TGCAAAGTAAGAATGACAAAAGG - Intergenic
1144779863 17:17802441-17802463 TGTAAAGTGAGATTAATGAAAGG + Intronic
1145720099 17:27063223-27063245 TTTAGAGTAATATTACCATATGG - Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1147010337 17:37441256-37441278 TGTAAAATAAGATGTCAAAAAGG + Intronic
1148556911 17:48584194-48584216 TGCAAAGGAAAAATACCAAATGG - Intronic
1150431077 17:65117890-65117912 TATAAAGCAAAATTAGCAAAGGG - Intergenic
1151171791 17:72252808-72252830 CGCAAAGTAATATCACCAAAAGG + Intergenic
1152489077 17:80616782-80616804 CGTAAAGTAAGTATAGCAAAGGG - Intronic
1155738720 18:29258242-29258264 TCTCAAGTAAGATTAACACAAGG - Intergenic
1155795577 18:30032529-30032551 TGTGAAGTATGATCAGCAAAAGG + Intergenic
1156205270 18:34878962-34878984 TTTAGATTAAGATTACCAAACGG + Intronic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1158350410 18:56559414-56559436 TATAAATTAATATTAACAAATGG - Intergenic
1159303106 18:66603191-66603213 TTCAAAATAAGTTTACCAAAGGG - Intronic
1159464054 18:68757361-68757383 TTTGAAATAATATTACCAAAAGG - Intronic
1164049537 19:21572806-21572828 TCAAAATTAAGATGACCAAAAGG - Intergenic
1164214957 19:23136256-23136278 TGTAAAGTAAGATTACCAAAGGG - Intronic
1164440699 19:28276579-28276601 TATAAAATAAGATTGACAAATGG - Intergenic
1165002055 19:32772308-32772330 TCTAAAGTGACATTACGAAAAGG - Intronic
1168091371 19:54087304-54087326 TATTAAGTAAGACCACCAAATGG + Intergenic
926616923 2:15005433-15005455 TGTAAAGTAAAATGATGAAAAGG - Intergenic
927078185 2:19601296-19601318 TATAAAGTAAAAATGCCAAACGG + Intergenic
927587671 2:24322989-24323011 TGTAAATTAAAATCACAAAAAGG + Intronic
928794040 2:34994455-34994477 TTTAAAGTAAGTTAACCAGATGG - Intergenic
929325124 2:40600733-40600755 AGTAAGATAAGATTATCAAAGGG - Intronic
929809519 2:45177965-45177987 TATAAAAGAAGATAACCAAATGG + Intergenic
929850026 2:45578334-45578356 TTTATAGTTAGATTTCCAAATGG - Intronic
931020781 2:58042594-58042616 TGTAAAGTATGCTTACTAAATGG + Intronic
932226772 2:70047647-70047669 TGAAAAGTAAAAATAGCAAAGGG + Intergenic
933088630 2:78090105-78090127 TGTGAAGTTACTTTACCAAAAGG - Intergenic
933888154 2:86739620-86739642 TGTAAAGCAAAATCACCAAAGGG + Intronic
933922024 2:87057086-87057108 TGTAAAGCAAAATCACCAAAGGG - Intergenic
935892637 2:107695759-107695781 TGTAAAGTAGCATTACTCAAGGG + Intergenic
937231586 2:120401094-120401116 TGTAAAACACGATTAACAAAAGG + Intergenic
937365696 2:121259601-121259623 TTAAAATTAAGATTACAAAAAGG + Intronic
939141125 2:138355782-138355804 TGCAAAATAAGATAAACAAAAGG + Intergenic
939178446 2:138779292-138779314 TTTAAAGTAAAATTACAGAAGGG - Intronic
939272446 2:139957973-139957995 TGTAAAGAAAGATAAAGAAAAGG + Intergenic
939399931 2:141678969-141678991 TCTGAGGTAAGGTTACCAAAAGG + Intronic
941361676 2:164559234-164559256 GGAAAAGTAAAATTACAAAATGG - Intronic
941852038 2:170193962-170193984 TGTGAAGTATGTTTACAAAAGGG - Intronic
941941183 2:171039865-171039887 TGTAAAGGAAAATTACAAAGGGG - Intronic
942286750 2:174425858-174425880 TGTAAATTAAAACTACCAATAGG - Intronic
943322414 2:186462048-186462070 TGTAATGTATGATTAACATATGG + Intergenic
943807154 2:192136544-192136566 TGTATAGTAGTATTACCAAGAGG + Intronic
944055547 2:195518563-195518585 TGCAAAGTAAAGATACCAAAGGG - Intergenic
945306656 2:208265766-208265788 TGTAAAGTCGGATTAATAAAAGG - Intronic
945450020 2:209983455-209983477 TTCAAAGGAAAATTACCAAATGG - Intronic
945500911 2:210573686-210573708 GGTTATGTGAGATTACCAAATGG + Intronic
945557588 2:211298519-211298541 TATAAAGTCAGATTACTAAAGGG + Intergenic
948073668 2:235148162-235148184 TGTAATGGAATATTACCCAAAGG - Intergenic
1169751229 20:8996816-8996838 TGTAAAGTAAGTTTCTCAAAGGG + Intergenic
1170666226 20:18388732-18388754 TGTAAAATAAAACTAACAAAAGG + Intronic
1172788219 20:37484444-37484466 TTCAAGGTTAGATTACCAAAAGG - Intergenic
1175011451 20:55741786-55741808 TGTAAAATAGAATTTCCAAAAGG - Intergenic
1176792894 21:13341286-13341308 TATAAAGAAAGAAAACCAAAGGG - Intergenic
1177011482 21:15735146-15735168 AGTAAAGCAACATGACCAAATGG - Intronic
1177027798 21:15942277-15942299 TGTAATGTAAGTTTACTAATGGG + Intergenic
1177588119 21:23125654-23125676 TGTTAAGTACTCTTACCAAAGGG - Intergenic
1177762395 21:25417196-25417218 TCTAAAGAATGAGTACCAAAAGG - Intergenic
1177992282 21:28052118-28052140 TATAAAGAAAGAAAACCAAAGGG - Intergenic
1179362439 21:40724571-40724593 AATAAAGTAAGATTATCAAAGGG + Intronic
1180487021 22:15811063-15811085 TGTAAAGCAAGATCACAAAGAGG + Intergenic
1181080119 22:20408296-20408318 TATAAAGTATGATCACCAAGAGG - Exonic
1181379202 22:22486475-22486497 TGTAAAGCAAGTTTCCCAAGGGG - Intronic
1182138205 22:27927070-27927092 TGTAGAGAAAGTTTACCAATTGG + Intergenic
1182139049 22:27936569-27936591 TCAAAAGTAATATTAACAAATGG + Intergenic
949616726 3:5761736-5761758 TGTGAAATTAGATTATCAAAAGG + Intergenic
949993035 3:9594993-9595015 GGTAAAGTAATATTGGCAAAAGG - Intergenic
952161708 3:30700305-30700327 TATAAATTAAGATTATTAAAGGG - Intergenic
953765635 3:45739085-45739107 TGTGAAGTAACATAAGCAAAGGG + Intronic
957140530 3:76349044-76349066 TAAACAGTAAGATTACCAGAAGG - Intronic
957145795 3:76422204-76422226 TGAAAAGTAAGCTTATAAAAAGG - Intronic
957898465 3:86454908-86454930 TGCAAAGCAAAATTAGCAAAGGG + Intergenic
957967113 3:87336507-87336529 TGTGAGTTAATATTACCAAAAGG - Intergenic
959190985 3:103111161-103111183 TGTGTAGTTAGATGACCAAATGG + Intergenic
959629281 3:108490263-108490285 TTTAAAGTACCCTTACCAAATGG - Intronic
962518147 3:136172724-136172746 TGTATAGTCAGATTCTCAAAGGG - Intronic
963506355 3:146189810-146189832 TGTAATGAAAGAAAACCAAAGGG - Intergenic
964026967 3:152085930-152085952 TCTAAAGTAAAATTACAAATGGG + Intergenic
964035077 3:152185841-152185863 TATAAAGTAAGACTGGCAAAAGG + Intergenic
964532628 3:157684721-157684743 TTAAAAGTAAAATTACAAAATGG - Intergenic
964579034 3:158209872-158209894 TATAAAGTATGATTACTACATGG - Intronic
964927976 3:161979748-161979770 TATAAAGACAGACTACCAAATGG - Intergenic
964929240 3:161996083-161996105 TGCAAAGTGAGATTACTCAAAGG - Intergenic
966533678 3:181007929-181007951 AGTAAAGAAAGATGACCATAAGG - Intergenic
967756379 3:193174711-193174733 TGCAAAGTCTTATTACCAAAGGG + Intergenic
968271593 3:197407481-197407503 TGAGAAGCAAGATTACGAAAAGG - Intergenic
969129036 4:4977485-4977507 TGCAAAGCAAAATTATCAAAGGG - Intergenic
972073251 4:35050803-35050825 TGTAAAGGAAGATTTTTAAATGG - Intergenic
974192217 4:58520339-58520361 TGTATACTAAGATTTGCAAATGG - Intergenic
974248143 4:59349323-59349345 TGTAAATTAAAATTAGCAAAGGG + Intergenic
974345473 4:60675869-60675891 TGAAAAATAACATTACCAACTGG - Intergenic
974395198 4:61324970-61324992 TGTAAAGTCAGAATTCCAAATGG - Intronic
975883302 4:78937220-78937242 TGCAAATGAAGATTACCAGATGG + Intronic
975926895 4:79466778-79466800 TGCAAAATTAGATGACCAAATGG - Intergenic
976883063 4:89953708-89953730 TGGAAAGTAATATTATAAAATGG + Exonic
976908164 4:90266434-90266456 TGTGGAGCAAGATGACCAAATGG + Intronic
976936180 4:90637459-90637481 TGTAAAGTATGAATACCAGGAGG + Intronic
977071684 4:92398013-92398035 TGTAAGGTAAGTTCTCCAAAAGG - Intronic
977763434 4:100769237-100769259 TGTAAAGTTAAATTTCTAAAAGG - Intronic
977854549 4:101874102-101874124 TGTAAAGTAAAATATGCAAAAGG - Intronic
977941743 4:102867286-102867308 TGTAAAATAAAAATACCAAGGGG + Intronic
978063767 4:104370882-104370904 TGTAAAGAAAGCTCACCACATGG + Intergenic
979134390 4:117090718-117090740 AGGCAAGCAAGATTACCAAATGG + Intergenic
979228254 4:118316432-118316454 TGTAATGTAAGTTTAGCAAAAGG - Intronic
981754415 4:148125880-148125902 TAAAAAGTAAGATTATCAAGTGG + Intronic
982156485 4:152527343-152527365 TGTAATTTATAATTACCAAATGG - Intronic
982610647 4:157569935-157569957 TGAAAAGTGAAATTAGCAAATGG + Intergenic
983350247 4:166577702-166577724 TGTAAACTCATATTACCCAATGG - Intergenic
983399955 4:167250218-167250240 TGAAAGGTAAAATTAACAAACGG - Intergenic
984346396 4:178532575-178532597 TGTAAATTAACATTACAAATAGG + Intergenic
984492139 4:180448133-180448155 TGTTTAGTAAGATTTTCAAAAGG - Intergenic
985331549 4:188842517-188842539 TGTAATGTAAGATTATTAGAAGG - Intergenic
986262077 5:6156289-6156311 TTCTAAGTAAGAATACCAAAAGG + Intergenic
987768037 5:22261366-22261388 TTGAAAGTAAAATGACCAAAAGG - Intronic
988094266 5:26583244-26583266 TGTAAAGAAAAATTACTACAGGG - Intergenic
988173742 5:27693530-27693552 TTTAAAGTTAGATAACAAAATGG - Intergenic
988253312 5:28788950-28788972 TATAAACTAAGATTACTTAATGG - Intergenic
988914509 5:35879027-35879049 TGTAATGTAAGATTACTAATTGG + Exonic
988964404 5:36401976-36401998 TGTAATGTAAGAAAAGCAAAAGG + Intergenic
989058864 5:37390155-37390177 TGTAGAGTGAGATTATCAGAGGG + Intronic
990265816 5:54074093-54074115 TCAACAGTAAAATTACCAAATGG - Intronic
991212960 5:64128665-64128687 TGTAAAATAATATAACCAATTGG - Intergenic
991271193 5:64783574-64783596 TCTAAAGGAAGAGTACCCAAGGG - Intronic
992444427 5:76820877-76820899 TGCAAAGTAACTTTCCCAAAGGG + Intronic
992735624 5:79716944-79716966 TTTACAGCAAGATTACCATATGG - Intronic
994837165 5:104870823-104870845 TGGAAATTAAGATTACCACCTGG + Intergenic
995215142 5:109586875-109586897 TTTAATGTAAGAGTACCGAAAGG + Intergenic
995408006 5:111823831-111823853 TGTAAAGTCAGATGACAAACAGG + Intronic
996460825 5:123740747-123740769 TATAAAATAAAATTATCAAATGG - Intergenic
996907063 5:128612842-128612864 TTTGAAGAAAGATTACAAAAGGG + Intronic
998419205 5:141968575-141968597 TGTAAAGTGAGAATAACAAATGG + Intronic
1003164256 6:3662406-3662428 TGTTTCGTAAGATTTCCAAAAGG - Intergenic
1005498343 6:26408216-26408238 TGTAAAGTCAAATGACAAAAGGG + Intronic
1005503012 6:26446271-26446293 TGTAAAGTCAAATGACAAAATGG + Intronic
1005693053 6:28326019-28326041 TGGAAAGTAAGATTTTCAAGTGG - Exonic
1005853939 6:29846103-29846125 TGTAAAGTAACATATCTAAATGG - Intergenic
1008304098 6:49879824-49879846 TGGCAAGTAAGTATACCAAAAGG - Intergenic
1008866569 6:56218411-56218433 TGTATAGTAAAATCACCATATGG + Intronic
1009361769 6:62823779-62823801 TTTAAGGTAAGATAACCAACAGG + Intergenic
1009823544 6:68836968-68836990 TGTAAATTAAGATCCTCAAAAGG - Intronic
1009882838 6:69590990-69591012 TGTAAAGTAAAATTATCTATTGG + Intergenic
1009908665 6:69899681-69899703 AGATAAGAAAGATTACCAAAAGG - Intronic
1010260785 6:73813997-73814019 TCCAAAGTAAGATAACCAGAAGG + Intronic
1011325314 6:86144599-86144621 TTCCAAGTAATATTACCAAAAGG + Intergenic
1012489083 6:99760103-99760125 GGTAAAGTAAGATTTAGAAAAGG + Intergenic
1013398015 6:109762916-109762938 TATAAAGTGACATTAACAAAGGG + Intronic
1014759403 6:125339613-125339635 AGTAGAGTAAGATTAGAAAAAGG + Intergenic
1014947868 6:127518022-127518044 TATAAAGAAATATTACCGAAGGG + Intronic
1015109852 6:129580316-129580338 TGTAAATTAAAATAAACAAATGG + Intronic
1015406148 6:132838701-132838723 TGTAAAATAGGATTGACAAATGG + Intergenic
1016928005 6:149372566-149372588 TGTAAAGCCAGATTAACATAGGG - Intronic
1019863414 7:3682372-3682394 TGTAAATTAACATTTCCAGAGGG + Intronic
1020454874 7:8360375-8360397 TGTAAATTTACATTACAAAAGGG + Intergenic
1020473875 7:8571567-8571589 TGTCAAGGAAGAGTCCCAAAAGG + Intronic
1021066443 7:16180265-16180287 TGTATATTAGCATTACCAAAAGG - Intronic
1023431639 7:40098605-40098627 TGTAAAGTAAGAAGACCGACTGG - Intergenic
1023452023 7:40296693-40296715 TATACAGGAAGGTTACCAAATGG - Intronic
1023784938 7:43696806-43696828 TGTAAAGAAAGAAAACAAAATGG - Intronic
1025194890 7:56925091-56925113 TGTAAAATATTATTAGCAAAGGG - Intergenic
1025677062 7:63651852-63651874 TGTAAAATATTATTAGCAAAGGG + Intergenic
1031404975 7:121374453-121374475 TGTCAAGTAAGTTTAAAAAATGG + Intronic
1031451976 7:121932680-121932702 TGTAATGTAATATTTCTAAATGG - Intronic
1032224875 7:130023362-130023384 TTTAAAGTTGGATGACCAAAGGG - Intronic
1033011374 7:137626109-137626131 TGCAAAGTAAAATCAACAAAGGG - Intronic
1033603274 7:142905748-142905770 TGTAAGGTAAGATTTCCATGAGG + Intergenic
1035586830 8:782712-782734 TGTAAAGAAAGAGTGCAAAAGGG - Intergenic
1038102506 8:24394208-24394230 TGTTAACTAAGATCTCCAAAGGG + Intronic
1040461504 8:47653349-47653371 GGGAAAGTAGGAATACCAAATGG + Intronic
1041036947 8:53801970-53801992 TGAAAAGTCAGATTACCTACTGG + Intronic
1044379414 8:91516561-91516583 AGTAAACTAGAATTACCAAAAGG + Intergenic
1045174595 8:99708304-99708326 TGAAAACTAAAAATACCAAAGGG - Intronic
1046372083 8:113323318-113323340 AGTAAAATAAAATAACCAAACGG + Intronic
1046878367 8:119280324-119280346 ATTAAAGTAAGAGTACCAGAAGG - Intergenic
1046928450 8:119818568-119818590 TGAAAAGTAAAATAATCAAAGGG + Intronic
1047058629 8:121196851-121196873 TGGAAAGTAAGAATAAAAAAAGG + Intergenic
1048222967 8:132560442-132560464 TGTAAAGCAAAATCAGCAAAAGG + Intergenic
1051127998 9:13826477-13826499 TGAAAAGAGAGATTAACAAATGG - Intergenic
1051242634 9:15075971-15075993 TTTAAAGGTAGATTACAAAATGG + Intergenic
1051255248 9:15206340-15206362 TGTAAATGAAAATTACCAAGAGG + Intronic
1051534332 9:18140351-18140373 TACAAAGTAAGATCAGCAAAGGG + Intergenic
1051653334 9:19352836-19352858 TTTAAAGTAAGATTATCAGCCGG + Intronic
1053079894 9:35166760-35166782 TGGGAAGTAAGAATACCGAATGG - Intronic
1053389347 9:37723102-37723124 TGTAATGAAATATCACCAAAGGG - Intronic
1055033733 9:71796209-71796231 TGCAAAGAAAAATTAGCAAAGGG + Intronic
1056042546 9:82683116-82683138 TACAAAGTAAGATTTCCACAAGG + Intergenic
1059439379 9:114297058-114297080 AGGAAAGAAAGATTACAAAAGGG + Intronic
1186444724 X:9617498-9617520 TGTTAATTAATATAACCAAATGG + Intronic
1187451315 X:19399134-19399156 TGACAATTAAGATTACTAAAGGG + Intronic
1188151095 X:26676624-26676646 TGTAAATTAAAGTTACCCAAAGG + Intergenic
1188231001 X:27663054-27663076 GTTAAAGTAATATTAGCAAATGG + Intronic
1188572834 X:31609952-31609974 TGTAAAGTCTGATAACCCAAGGG - Intronic
1189544875 X:42032314-42032336 TGTATAGCAAGAGTACCAAAAGG - Intergenic
1189812207 X:44791132-44791154 TGTATTTTAAGATTACCTAACGG - Intergenic
1191115106 X:56844247-56844269 TGTAAAGAATGATTTCTAAAAGG + Intergenic
1191713424 X:64176917-64176939 TGTAAAGGAAGAAGACAAAATGG - Intergenic
1193053712 X:77127386-77127408 TGTAAATTAAGTTTACCACCTGG + Intergenic
1194400799 X:93436202-93436224 TTTAAAATAAGATTAAGAAATGG + Intergenic
1195505568 X:105652721-105652743 TGTGAAGTAAGATTAATAAGTGG - Intronic
1196862952 X:120044567-120044589 TGTAAAGAAAGATTACAATGTGG + Intergenic
1196880150 X:120191777-120191799 TGTAAAGAAAGATTACAATGTGG - Intergenic
1198238932 X:134764218-134764240 TATTAATAAAGATTACCAAAGGG + Intronic
1199092518 X:143708411-143708433 AGTAAAGTGAGATGGCCAAAGGG + Intergenic
1199168238 X:144703024-144703046 TGGAAAGAAAGATTGCCTAAGGG + Intergenic
1199571770 X:149273679-149273701 TGTGAAGTAAGATTCCCAGTGGG + Intergenic