ID: 1164215071

View in Genome Browser
Species Human (GRCh38)
Location 19:23137758-23137780
Sequence CTCTGGGCTTATAGTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 8, 3: 38, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164215063_1164215071 -4 Left 1164215063 19:23137739-23137761 CCCAGGGTGATAGAATGCCCTCT No data
Right 1164215071 19:23137758-23137780 CTCTGGGCTTATAGTGGAGAGGG 0: 1
1: 0
2: 8
3: 38
4: 236
1164215064_1164215071 -5 Left 1164215064 19:23137740-23137762 CCAGGGTGATAGAATGCCCTCTG 0: 2
1: 1
2: 5
3: 18
4: 378
Right 1164215071 19:23137758-23137780 CTCTGGGCTTATAGTGGAGAGGG 0: 1
1: 0
2: 8
3: 38
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164215071 Original CRISPR CTCTGGGCTTATAGTGGAGA GGG Intronic
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
901431251 1:9216358-9216380 TCCTAGGCTTACAGTGGAGAAGG - Intergenic
904839749 1:33364676-33364698 CTCTGGGCTTACAGAGAGGAAGG + Intronic
906247824 1:44289586-44289608 CTGTGTGCTTATAGGGGTGAGGG - Intronic
913281189 1:117186658-117186680 ATCTGGACTTGAAGTGGAGAGGG - Intronic
913996034 1:143652467-143652489 CTCTGAGCTTACAGTGGACAGGG + Intergenic
915584535 1:156837229-156837251 CCCTGGGCATATAGTGCAGAAGG - Intronic
916057318 1:161076658-161076680 CTCTGAGCTTAGAGAGGGGAGGG - Intronic
918019188 1:180668297-180668319 TTGTGGGCTTTTAGTAGAGACGG + Intronic
918820131 1:189243115-189243137 CTCTATGCTTATAGTTGAGGAGG + Intergenic
920385992 1:205570164-205570186 CTCTCGGCTTAAATTGGACAGGG + Intronic
921596955 1:217064909-217064931 CTCTGGGCTTTTAATGAGGAAGG + Intronic
921744511 1:218724078-218724100 GTGTGTGCTTTTAGTGGAGATGG - Intergenic
922356516 1:224781437-224781459 TTCTGGGCTTATAGGAAAGAAGG - Intergenic
922687227 1:227651120-227651142 TTCTGGGTTCATAGTAGAGAGGG + Intronic
922801897 1:228368272-228368294 GGCTGGGCTTAAAGTGGAGAGGG + Intronic
923621410 1:235582391-235582413 CTCTGAGCTGATAGTGGAGGAGG - Intronic
924635334 1:245781797-245781819 ATTTGGACTTTTAGTGGAGACGG - Intronic
1063104957 10:2984958-2984980 CTCTGGCCTTTTAGTGGCCACGG - Intergenic
1064050519 10:12055672-12055694 TTCTGTGCTTTTAGTAGAGATGG - Intergenic
1064515456 10:16142840-16142862 TTTTGTGCTTTTAGTGGAGATGG - Intergenic
1067995831 10:51272342-51272364 CACTGGGCTTATCGTGGGGTGGG + Intronic
1068433629 10:56963429-56963451 GTCTGGGCATACAGTGGAGAGGG - Intergenic
1069863552 10:71486300-71486322 CTCTGGGATTACAGAGGAAAGGG + Intronic
1070906285 10:80076319-80076341 CGCTTGGCTAATTGTGGAGACGG - Intergenic
1070964110 10:80519046-80519068 CCCTGGGCTTGCAGTGGGGAGGG - Exonic
1072157090 10:92733636-92733658 CTCTTGGTTTATGCTGGAGAGGG - Intergenic
1073411763 10:103348493-103348515 CTCCTGGCTAATAGTGGAGATGG + Intronic
1075609543 10:123841283-123841305 CTCAGGGCTGGTTGTGGAGACGG - Intronic
1076804711 10:132849662-132849684 CCCTGGGCTGAGAGTGAAGAAGG + Intronic
1077579746 11:3409187-3409209 CCCTGGGCTTATGGTGCAGCAGG - Intergenic
1078570438 11:12453118-12453140 CTCTGGGGTTTGAGTTGAGATGG + Intronic
1083599512 11:63938332-63938354 CTCAGGGTTTAGAGGGGAGACGG - Intergenic
1084036246 11:66512628-66512650 CTCTGGGCTTACAATAGTGAGGG + Intronic
1084236761 11:67792708-67792730 CCCTGGGCTTACAGTGCAGCAGG - Intergenic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1085787982 11:79471788-79471810 CTCTGGCCTTGTTGTGGAGTGGG + Intergenic
1085989777 11:81827895-81827917 CTCTGTATTTTTAGTGGAGACGG + Intergenic
1087546259 11:99588020-99588042 TTTTGGGCTCACAGTGGAGAAGG - Intronic
1087970041 11:104469313-104469335 CTCTGTACTGATAGAGGAGAAGG + Intergenic
1088028731 11:105219772-105219794 GTCTGTATTTATAGTGGAGACGG - Intergenic
1088768259 11:113006871-113006893 CTATGGTCTTAAAGTGGAAATGG - Intronic
1089364455 11:117912675-117912697 CTAAGGGCATACAGTGGAGAGGG - Intronic
1090208322 11:124897843-124897865 CTCTGAGCTCACAGTGAAGAGGG + Exonic
1091267669 11:134283231-134283253 TTCTGTACTTTTAGTGGAGACGG + Intronic
1091323134 11:134665539-134665561 CTCTGGGCTTAGGGAGGAGGAGG - Intergenic
1092396268 12:8129618-8129640 TTTTGTGCTTTTAGTGGAGACGG - Intronic
1092558990 12:9589656-9589678 TTCTGTGTTTCTAGTGGAGATGG - Intergenic
1092579434 12:9821919-9821941 CTTTGGTCTCATAGTGGAGTGGG - Intergenic
1095782755 12:46078260-46078282 CTCTGGGCTTGTAATGGAAGGGG + Intergenic
1096679473 12:53245854-53245876 CTCTTGGGTTATAGAAGAGAAGG + Intergenic
1100660457 12:96692755-96692777 CACTGGGCTTCTTCTGGAGAAGG - Intronic
1101709169 12:107248957-107248979 TTCTGGGCTTATTTTGGAGAGGG - Intergenic
1102146822 12:110660653-110660675 TTCTGGAATTATAGTGGTGATGG - Intronic
1102651698 12:114447104-114447126 CCCTGAGCTTCTGGTGGAGAAGG + Intergenic
1102755697 12:115338185-115338207 AACTGGGCTCAGAGTGGAGAAGG + Intergenic
1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG + Intergenic
1110256106 13:73435652-73435674 CACTGGGCTTATAGTGAAGAGGG - Intergenic
1114482446 14:23044204-23044226 GTCTGGGCTTCTAGGGGAGTGGG - Exonic
1115512201 14:34148507-34148529 CACTGGGCTTACAGTGGTGCAGG + Intronic
1115970979 14:38944535-38944557 CTATGGTCTTATAGTGGGGCTGG + Intergenic
1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG + Intronic
1118431165 14:65720239-65720261 CTGTGGGCTTGTAGTGGTGGTGG - Intronic
1202829531 14_GL000009v2_random:11825-11847 TTCTGCGCATATAGTGGATAAGG + Intergenic
1124081340 15:26501079-26501101 CTGTGGGCCTATAGTGGTGGTGG - Intergenic
1125120067 15:36145699-36145721 TTCTGGGAATATAGTGGAGAAGG + Intergenic
1125677258 15:41509081-41509103 CTCTGGGCTGATGGGGAAGATGG - Exonic
1128903934 15:71451005-71451027 CTCTGCATTTTTAGTGGAGACGG - Intronic
1129534429 15:76300531-76300553 CTGTGGGGTAATAGAGGAGAAGG - Intronic
1129651208 15:77491560-77491582 TTGTGGGCTTCCAGTGGAGAGGG - Intergenic
1130935743 15:88468837-88468859 TTTTGTGCTTTTAGTGGAGACGG - Intronic
1131155879 15:90075129-90075151 CTCTGGCCTCATGGTGGGGAGGG + Intronic
1131636517 15:94238617-94238639 CTCAGAGCTTACAGTTGAGAGGG + Intronic
1132896363 16:2231125-2231147 CTGTTGGCCTCTAGTGGAGATGG + Intronic
1135166765 16:20146117-20146139 CACTGGGCTCATAGGGGAAATGG - Intergenic
1136649098 16:31650783-31650805 CTCTGCACTTCTAGTAGAGATGG - Intergenic
1136649216 16:31652004-31652026 CTCTGGACTTCTAGTAGAGACGG - Intergenic
1138565352 16:57828780-57828802 GGCTGGGCTTGTAGTGGAGAGGG - Intronic
1139509445 16:67418465-67418487 CTTTGTACTTTTAGTGGAGATGG - Intergenic
1139775685 16:69315792-69315814 GTCTGAGCTTATTGTGAAGATGG + Intronic
1140074115 16:71681126-71681148 GTCTGGGCTTCTGGAGGAGAAGG - Intronic
1141210273 16:81973284-81973306 CTCTGAGCTTTAATTGGAGAAGG + Intergenic
1141587509 16:85044675-85044697 TTCTGTGCTTTTAGTAGAGACGG + Intronic
1141895811 16:86958005-86958027 GTCTGTGTTTACAGTGGAGATGG - Intergenic
1142606036 17:1081522-1081544 CTCTGTCCTCATTGTGGAGAGGG + Intronic
1143289662 17:5819451-5819473 ATCTGGGCATAGAGTGGAGTGGG + Intronic
1144162636 17:12576628-12576650 CTCAGGGCTTACATTGTAGAAGG + Intergenic
1145371934 17:22313925-22313947 CTTTGTCCTTTTAGTGGAGATGG + Intergenic
1145416112 17:22715291-22715313 CTGTGGACTTATAGTGGAGCTGG + Intergenic
1145886591 17:28386121-28386143 TTTTGTGCTTTTAGTGGAGATGG - Intronic
1146395213 17:32459795-32459817 AGCTGGGATTATAGTAGAGATGG + Intronic
1146840400 17:36148995-36149017 CACTGGGCTTATATTGCAAATGG + Intergenic
1147957023 17:44141828-44141850 CTCTGGTCTTAAAGGGGAAACGG - Intergenic
1149114234 17:53072507-53072529 ATCTGGGGATAGAGTGGAGAGGG + Intergenic
1151277512 17:73046769-73046791 CTTTTGCCTTTTAGTGGAGATGG - Intronic
1151311327 17:73294178-73294200 TTCTGTGTTTTTAGTGGAGATGG - Intronic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153915506 18:9741203-9741225 TTTTGTGCTTTTAGTGGAGACGG - Intronic
1155276350 18:24191298-24191320 CTTTTGGCATCTAGTGGAGAAGG + Intronic
1155325851 18:24664160-24664182 CTCTGGGCTTCTGGTAGTGAAGG + Intergenic
1156643299 18:39128294-39128316 CTATGGCCTTATAGTGAAGTTGG - Intergenic
1158187581 18:54788471-54788493 TTTTGTGCTTTTAGTGGAGATGG + Intronic
1158872906 18:61706392-61706414 CTAGGGGCTAATATTGGAGAGGG - Intergenic
1162138930 19:8573677-8573699 TTTTGTGCTTTTAGTGGAGACGG - Intronic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164014690 19:21242954-21242976 CTCTGGGTTTGTAGTGGAGTTGG - Intronic
1164031276 19:21408001-21408023 CTCTGGGTTTGTAGTGGAGTGGG + Intronic
1164102938 19:22075081-22075103 CTCTGGGTTTGTGATGGAGAGGG + Intronic
1164113359 19:22191790-22191812 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164197755 19:22986086-22986108 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164215071 19:23137758-23137780 CTCTGGGCTTATAGTGGAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164347914 19:27290222-27290244 CTTTGGGCCTATAGTGGAAAAGG + Intergenic
1164350881 19:27339088-27339110 CTTTGGGCATATGGTGGAAAAGG - Intergenic
1164505304 19:28855446-28855468 CTCTAGGGTAAAAGTGGAGAAGG + Intergenic
1165237708 19:34436155-34436177 GTCTGGGCTTATAATGTGGAAGG + Intronic
1166710832 19:44936121-44936143 CTCTTGGATTTTGGTGGAGAGGG + Intergenic
1167106847 19:47435417-47435439 CTCTGGGGACTTAGTGGAGACGG - Intronic
1167257478 19:48439771-48439793 TTCTGTACTTTTAGTGGAGATGG - Intronic
1167446732 19:49542493-49542515 CTCTGGGGGTCTAGTGGAGCTGG - Intronic
1167520145 19:49949996-49950018 CTTTGGGCTTCAATTGGAGAGGG - Exonic
1202643163 1_KI270706v1_random:115956-115978 TTCTGCGCATATAGTGGATAAGG - Intergenic
925214704 2:2084496-2084518 CCCTGGGCTAGGAGTGGAGAGGG + Intronic
927209730 2:20631729-20631751 CTCTGGCCCCATTGTGGAGAAGG - Intronic
928197483 2:29225969-29225991 CACTGGGCTCACAGTGGGGAGGG + Intronic
931939234 2:67233722-67233744 GTCTTGGCTTACAGTGTAGAGGG - Intergenic
932212568 2:69944778-69944800 CTCTGTGCCTATTGTGAAGAAGG + Intergenic
933172936 2:79143617-79143639 TTTTGGGCTTTTAGTAGAGACGG + Intergenic
934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG + Intronic
934979985 2:98831762-98831784 CTCTTGGATTCTAATGGAGAAGG + Intronic
936651605 2:114433567-114433589 CTATGGGCATAGAGTGGGGAGGG + Intergenic
936824457 2:116564107-116564129 CTCTGAGCTTGTAGCTGAGATGG + Intergenic
937758788 2:125574425-125574447 CTCTAGGCTTATAATGAATAAGG - Intergenic
938534655 2:132227689-132227711 TTTTGGGCCTATAGTGGAAAAGG + Intronic
941166199 2:162085723-162085745 ATCTCTGCTTATACTGGAGAGGG + Intergenic
942338474 2:174917019-174917041 CTTTGTGTTTTTAGTGGAGATGG - Intronic
943284664 2:185982298-185982320 CTCTGGGTTTAAATTTGAGAAGG - Intergenic
945469910 2:210215852-210215874 CTCTGTGCTTATTGAGGAGAAGG - Intronic
945968825 2:216216775-216216797 CTCTGGGCTTCTGCTGGAGGAGG - Intergenic
1169351369 20:4870858-4870880 TTCTGGTATTATAGTAGAGAAGG - Intronic
1169873707 20:10273786-10273808 CTCTTGTCTTGTAGCGGAGATGG - Intronic
1170113017 20:12825765-12825787 CTGTTGGCTTAAAGTGGTGATGG - Intergenic
1170356555 20:15497878-15497900 CTTTGGGCTTTTAGAGGACAGGG + Intronic
1171519424 20:25764681-25764703 CTGTGTACTTATAGTGGAGCTGG + Intronic
1171557495 20:26091810-26091832 CTGTGGACTTACAGTGGAGCTGG - Intergenic
1171890280 20:30706160-30706182 TTCTGTGCATATAGTGGATAAGG - Intergenic
1172170171 20:32925521-32925543 TTTTGGGTTTTTAGTGGAGACGG + Intronic
1173987751 20:47275713-47275735 CTCTGGGACTATAGTTGAGGTGG - Intronic
1175255608 20:57645125-57645147 CTCTGGGCCTATAATGGGAAGGG - Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1175557309 20:59875915-59875937 TTCTGGGCATACACTGGAGAAGG + Intronic
1176608716 21:8856667-8856689 TTCTGCGCATATAGTGGATAAGG + Intergenic
1176763760 21:12992859-12992881 TTTTGGGCCTATAGTGGAAAAGG - Intergenic
1179301795 21:40118414-40118436 TTCTGTGGTTTTAGTGGAGATGG - Intronic
1180358803 22:11866485-11866507 TTCTGCGCATATAGTGGATAAGG + Intergenic
1181360623 22:22331262-22331284 CACCAGGCATATAGTGGAGAAGG + Intergenic
1181828702 22:25541167-25541189 CTCTGTCCTTTTAGTGGAGAGGG + Intergenic
1182788616 22:32929724-32929746 ATCTCAGCTTATTGTGGAGAGGG + Intronic
1183726416 22:39592408-39592430 CTCTGGGCTTGCTGTGGAGCTGG + Intronic
1184281456 22:43439937-43439959 CTCTGGGCGTACAGAGGAGCAGG - Intronic
1184904699 22:47473041-47473063 CTCTGGGCTTGTGATGGACATGG + Intronic
950368159 3:12503934-12503956 CTCTGGGGTTTTAGTTGAAATGG - Intronic
951690948 3:25396163-25396185 CTCCAGGCTTATAATGGGGAGGG + Intronic
953054365 3:39376004-39376026 CTTTGGGCTCAAACTGGAGAAGG + Intergenic
953165383 3:40460345-40460367 TTTTGGACTTTTAGTGGAGACGG - Intronic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953968925 3:47332177-47332199 TTCTGTGCTTTTAGTAGAGATGG - Intronic
954103161 3:48393447-48393469 ACCTGGGCTTCTGGTGGAGAGGG + Intronic
954224974 3:49175528-49175550 CTCTGGGCTTAGGGAGCAGAAGG + Intronic
955575856 3:60362505-60362527 CTGTGTGCTTATTGTGGATAAGG + Intronic
956149081 3:66222350-66222372 TTTTGGGTTTTTAGTGGAGACGG + Intronic
958201227 3:90317875-90317897 CTTTGGGCCTATAGTAGACAAGG - Intergenic
959712715 3:109401023-109401045 CTTTGTGTTTTTAGTGGAGATGG + Intergenic
960009241 3:112815368-112815390 CTCTGGGCTTGTTGTGGGAAGGG - Intronic
960352303 3:116608035-116608057 CTATGGGGTTATATTGGAAAGGG - Intronic
960516603 3:118608665-118608687 CTCTGGGCTGATACTGGGGATGG - Intergenic
961135182 3:124503420-124503442 ATTTGGGCTTAGAGTGGAGATGG - Intronic
962236371 3:133710832-133710854 CTCTGGCCTTAAAGAGGAGGAGG - Intergenic
963672424 3:148268754-148268776 CTCTGAGCTTGTAATGGAGGTGG + Intergenic
964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG + Intergenic
967509458 3:190292451-190292473 CTCTGGGCCTATGATGGAAAGGG + Intergenic
969255433 4:5998597-5998619 CTCTGGGATGACAGTGGACAAGG + Intergenic
969595723 4:8148362-8148384 CTCTGGGCCTACAGTGAAGCAGG + Intronic
969818430 4:9703355-9703377 CCCTGGGCTTATGGTGCAGCAGG + Intergenic
970617564 4:17781856-17781878 CTCCGAGCTGATAGCGGAGATGG + Intergenic
975240106 4:72047328-72047350 CTCTGGGCCTATAATGGAAGGGG - Intronic
975766652 4:77675451-77675473 CTCTGTGATTATGGAGGAGATGG + Intergenic
977394694 4:96455549-96455571 GTCTGGGCTTAGTGTGGAGCCGG - Intergenic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
982162825 4:152587113-152587135 ACCTGGCCATATAGTGGAGAAGG + Intergenic
983516460 4:168662306-168662328 CTATGGGCTAAGAGTGGAGAGGG - Intronic
983693792 4:170503973-170503995 TTCTGGACTTTTAATGGAGAAGG + Intergenic
986869595 5:12031137-12031159 CTCTGGGCCTATGGTGGAAGGGG - Intergenic
989943550 5:50186691-50186713 CTTTGAGCTTATTGTGGAAAAGG - Intergenic
990382723 5:55232575-55232597 CGCTGGGCTTAGGGTGGAGAGGG + Intronic
991197759 5:63956220-63956242 CTGTGGGCTCATAGTGGGAAGGG - Intergenic
991282408 5:64930293-64930315 TTCTGGAATTATAGTGGTGACGG + Intronic
992565569 5:77992527-77992549 TTCTGGGCTTCTACTGGAGAAGG + Intergenic
992745160 5:79812231-79812253 CCCTGGTCTTATACTCGAGAGGG - Intergenic
994649030 5:102504110-102504132 CTCTGGGCTTGTAATGGGAAGGG - Intergenic
994824790 5:104699028-104699050 GTCTGGGCTTGAAGTTGAGAGGG - Intergenic
997108529 5:131048361-131048383 CTCTGTACTTTTAGTAGAGATGG - Intergenic
999164120 5:149533264-149533286 TTCGTGGCTTATAGTGGGGAAGG + Intronic
1000043385 5:157501661-157501683 CTCTGGGCTCATGGTGGTGGGGG + Intronic
1002777502 6:341520-341542 CTCTGGGCTTTTCTTGGAAAAGG + Intronic
1002827288 6:785121-785143 CCCTGGGCTTCTTGTGGAGATGG - Intergenic
1006992525 6:38227711-38227733 CTCTGAGAGTATAATGGAGAAGG + Intronic
1009255710 6:61393594-61393616 CTTTGGGACTATAGTGGAAAAGG + Intergenic
1011481277 6:87796345-87796367 CTCTTGTCTTTTAGTAGAGAGGG - Intergenic
1011957198 6:93037708-93037730 GCCTGGGCATAGAGTGGAGAGGG + Intergenic
1012933962 6:105346234-105346256 CTTTGGGCGTAGAGTGGAAAAGG - Intronic
1013353281 6:109325182-109325204 CTCTGGGCTTATTGTGAAGTAGG + Intergenic
1013417583 6:109938671-109938693 CTCTGGACTTATAGTTGGGTGGG - Intergenic
1015350356 6:132210595-132210617 GCCTGGGCATAGAGTGGAGAGGG + Intergenic
1017518108 6:155176169-155176191 CTCTGGGATCATGGTTGAGAAGG - Intronic
1017947922 6:159110914-159110936 AGCTGGGCTGATGGTGGAGATGG + Intergenic
1018503931 6:164443699-164443721 CTCTGGGCCTATGATGGAAATGG - Intergenic
1021280950 7:18717599-18717621 CTCTGTATTTTTAGTGGAGATGG + Intronic
1024608012 7:51038785-51038807 CTCTAGGCTGAGAGTGGAGTTGG - Intronic
1025164164 7:56695986-56696008 TTTTGGGCTTGCAGTGGAGATGG - Intergenic
1025279909 7:57619621-57619643 CTGTGGACTTATAGTGGAGCTGG + Intergenic
1025304825 7:57845880-57845902 CTGTGGACTTATAGTGGAGCTGG - Intergenic
1025706118 7:63866085-63866107 TTTTGGGCTTGCAGTGGAGATGG + Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026043373 7:66887421-66887443 TTCTGTACTTTTAGTGGAGACGG + Intergenic
1028245530 7:88472192-88472214 CTTTGTGCTTTTAGTAGAGACGG + Intergenic
1030719468 7:112852513-112852535 GTCTGGGCTTTTAGTGTAAATGG - Intronic
1035193819 7:157197940-157197962 TTCAAGGCTTTTAGTGGAGAAGG - Intronic
1036626126 8:10473413-10473435 CCCTGGGCTTAAAGTTCAGAAGG - Intergenic
1038615409 8:29089534-29089556 CTCAGGGAATATTGTGGAGAGGG + Intronic
1041491709 8:58439733-58439755 TTCAAGGCTTTTAGTGGAGAAGG + Exonic
1041887669 8:62830635-62830657 GCCTGGGCTTGGAGTGGAGAGGG - Intronic
1043853652 8:85241488-85241510 TTTTGTGCTTTTAGTGGAGACGG - Intronic
1044730823 8:95227226-95227248 CTCTGAGCACATAATGGAGATGG - Intergenic
1046445210 8:114310622-114310644 CTCAGGTCTTATAATGGAAATGG + Intergenic
1048784361 8:138034809-138034831 TTTTGTGCTTTTAGTGGAGATGG - Intergenic
1049309306 8:141924915-141924937 CCCTGGGCTTCTGGGGGAGAGGG - Intergenic
1049646799 8:143739219-143739241 CTCTGGGCTTCTTGTTGGGAGGG + Intergenic
1050962095 9:11747302-11747324 CTCTAGGCTTATGGCTGAGATGG + Intergenic
1052003865 9:23322776-23322798 TTATGTTCTTATAGTGGAGATGG - Intergenic
1052017648 9:23487848-23487870 CTCTGAGGTTATAGTGGTGCTGG + Intergenic
1052307259 9:27024352-27024374 CTCTGGGCTTGTACTTGGGAGGG - Intronic
1052524715 9:29600629-29600651 TTATGGGCTTAAAATGGAGAGGG + Intergenic
1053711752 9:40818771-40818793 TTTTGGGCATATAGTGGAAAAGG + Intergenic
1053938022 9:43189229-43189251 TTTTGGGCTTATAGTGGAAAAGG + Intergenic
1053938679 9:43201678-43201700 TTTTGGGCCTATAGTGGAAAAGG + Intergenic
1054358616 9:64090035-64090057 TTCTGTGCATATAGTGGATAAGG + Intergenic
1054422291 9:64952017-64952039 TTTTGGGCATATAGTGGAAAAGG + Intergenic
1055777948 9:79786595-79786617 TTCTGAGCTAATAGTGGAAAGGG - Intergenic
1055782378 9:79833266-79833288 CTCTGGGATTATAATGGAAAGGG + Intergenic
1056649435 9:88445237-88445259 GTCTGGGCTTAGAGTAGACAAGG - Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1061677723 9:132227838-132227860 CCCTGGGCTGCAAGTGGAGAAGG + Intronic
1203704114 Un_KI270742v1:21880-21902 TTCTGCGCATATAGTGGATAAGG + Intergenic
1203559888 Un_KI270744v1:43941-43963 TTCTGCGCATATAGTGGATAAGG - Intergenic
1185782393 X:2860898-2860920 TTTTGTGCTTTTAGTGGAGACGG + Intronic
1187576465 X:20561801-20561823 CTCTGGGCCTATAATGGAAGTGG - Intergenic
1188187551 X:27133235-27133257 CTCTGGGTTATTACTGGAGAAGG - Intergenic
1188848048 X:35098466-35098488 CTCTGTGATTATAGTAGAGCTGG + Intergenic
1189091834 X:38091577-38091599 ACCTGGGCTTATAGATGAGAGGG + Intronic
1189218549 X:39349371-39349393 CTATGGCCTTATAGTGTAGTTGG - Intergenic
1191212500 X:57903172-57903194 GTCTGGGCTTATATTGTACAAGG + Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193695862 X:84707308-84707330 GTCTGGGCTGATAGTAGAGGGGG + Intergenic
1197080389 X:122406298-122406320 TTCTGTGCTTTTAGTAGAGACGG - Intergenic
1199083661 X:143605727-143605749 CTCTGGGCTTATAATGGCAGGGG - Intergenic
1199329596 X:146543197-146543219 CTCTGGGCTTATGATGGGAAGGG + Intergenic