ID: 1164217550

View in Genome Browser
Species Human (GRCh38)
Location 19:23163038-23163060
Sequence GGCAACTGGTCTGGGTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164217545_1164217550 -1 Left 1164217545 19:23163016-23163038 CCGTGAGCAAGTGTCTATGTACG No data
Right 1164217550 19:23163038-23163060 GGCAACTGGTCTGGGTGCCCTGG No data
1164217544_1164217550 3 Left 1164217544 19:23163012-23163034 CCAGCCGTGAGCAAGTGTCTATG No data
Right 1164217550 19:23163038-23163060 GGCAACTGGTCTGGGTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164217550 Original CRISPR GGCAACTGGTCTGGGTGCCC TGG Intergenic
No off target data available for this crispr