ID: 1164225934

View in Genome Browser
Species Human (GRCh38)
Location 19:23245978-23246000
Sequence TAGCCTGCTCACTCCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 3, 2: 8, 3: 42, 4: 309}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164225934_1164225939 -5 Left 1164225934 19:23245978-23246000 CCATGGCTGGAGTGAGCAGGCTA 0: 1
1: 3
2: 8
3: 42
4: 309
Right 1164225939 19:23245996-23246018 GGCTAGGAAATCTGCAGGGGAGG 0: 1
1: 1
2: 8
3: 23
4: 190
1164225934_1164225936 -10 Left 1164225934 19:23245978-23246000 CCATGGCTGGAGTGAGCAGGCTA 0: 1
1: 3
2: 8
3: 42
4: 309
Right 1164225936 19:23245991-23246013 GAGCAGGCTAGGAAATCTGCAGG 0: 1
1: 1
2: 12
3: 27
4: 125
1164225934_1164225941 17 Left 1164225934 19:23245978-23246000 CCATGGCTGGAGTGAGCAGGCTA 0: 1
1: 3
2: 8
3: 42
4: 309
Right 1164225941 19:23246018-23246040 GCTCCCCAGGAAGAACTAACTGG 0: 3
1: 6
2: 10
3: 18
4: 123
1164225934_1164225938 -8 Left 1164225934 19:23245978-23246000 CCATGGCTGGAGTGAGCAGGCTA 0: 1
1: 3
2: 8
3: 42
4: 309
Right 1164225938 19:23245993-23246015 GCAGGCTAGGAAATCTGCAGGGG 0: 1
1: 2
2: 7
3: 30
4: 178
1164225934_1164225940 4 Left 1164225934 19:23245978-23246000 CCATGGCTGGAGTGAGCAGGCTA 0: 1
1: 3
2: 8
3: 42
4: 309
Right 1164225940 19:23246005-23246027 ATCTGCAGGGGAGGCTCCCCAGG 0: 1
1: 6
2: 4
3: 27
4: 255
1164225934_1164225942 18 Left 1164225934 19:23245978-23246000 CCATGGCTGGAGTGAGCAGGCTA 0: 1
1: 3
2: 8
3: 42
4: 309
Right 1164225942 19:23246019-23246041 CTCCCCAGGAAGAACTAACTGGG 0: 2
1: 6
2: 12
3: 24
4: 126
1164225934_1164225937 -9 Left 1164225934 19:23245978-23246000 CCATGGCTGGAGTGAGCAGGCTA 0: 1
1: 3
2: 8
3: 42
4: 309
Right 1164225937 19:23245992-23246014 AGCAGGCTAGGAAATCTGCAGGG 0: 1
1: 1
2: 9
3: 32
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164225934 Original CRISPR TAGCCTGCTCACTCCAGCCA TGG (reversed) Intronic
900315084 1:2052350-2052372 GAGCCTGGTCTCTCCAGCCTGGG - Intronic
900660922 1:3783066-3783088 TAGCCACCTCACTCCAGCCTGGG + Intronic
900799601 1:4729019-4729041 CCTCCTGCTCACTCCAGCCCTGG + Intronic
901345282 1:8535100-8535122 TAGCCACCTCACTCTAGCCTGGG + Intronic
901574061 1:10185717-10185739 TAGCCACCACACTCCAGCCTGGG + Intergenic
902216890 1:14939964-14939986 TAGCCTGATCATCCCACCCAGGG + Intronic
904566017 1:31428899-31428921 CAGCCCACTCACACCAGCCAAGG - Intronic
904572065 1:31473596-31473618 TGTCCTACCCACTCCAGCCATGG - Intergenic
904750205 1:32737221-32737243 AAGACTCCTCACTCCAGACAGGG - Intergenic
906671929 1:47662225-47662247 TAGCCAGTGCACTCCAGCCTGGG - Intergenic
906793614 1:48679427-48679449 AAGCCTGCTCAGTACAACCAGGG + Intronic
907137135 1:52150374-52150396 TAGCCACCCCACTCCAGCCTGGG + Intronic
908347868 1:63253735-63253757 TAGCCACCACACTCCAGCCTGGG + Intergenic
908752224 1:67435340-67435362 CAGCCCGCGCACTCCAGCCTGGG - Intergenic
909621169 1:77669497-77669519 GCGCCTGTTCACTCCAGCCTGGG - Intronic
910926387 1:92402412-92402434 TAGTCACCTCACTCCAGCCTGGG - Intergenic
912467301 1:109882916-109882938 TTTCTTGCTCACTGCAGCCATGG + Intergenic
914385498 1:147165838-147165860 GAGCCTCCTCACTCCAGCCTGGG - Intronic
914922138 1:151854286-151854308 TAGCCACCGCACTCCAGCCTGGG + Intergenic
915049899 1:153057627-153057649 TATCCTGCTCATGCCAGTCATGG - Intergenic
915201266 1:154231189-154231211 TAGCATGATCACTGCAGCCATGG + Intronic
916675440 1:167061380-167061402 TAGTCTAGTGACTCCAGCCATGG - Intronic
917151879 1:171954660-171954682 ATGCCTGCTCACTCCTGCAAGGG + Intronic
917347851 1:174047157-174047179 TAGCCAGTGCACTCCAGCCTAGG - Intergenic
918045045 1:180936386-180936408 CAGCCTGAGCAGTCCAGCCAGGG - Exonic
918203130 1:182285947-182285969 TAGCCTCTACACTCCAGCCTGGG + Intergenic
921052253 1:211518926-211518948 TAGCTTGGCCATTCCAGCCACGG - Intergenic
922789394 1:228302736-228302758 TTGCCTCCTGACTCCAGGCAGGG - Intronic
922918849 1:229283516-229283538 AAGCCTGCTCTCTGTAGCCATGG - Intronic
923578689 1:235186451-235186473 TTGCCAGCGCACTCCAGCCTGGG - Intronic
923615922 1:235537235-235537257 TAGTGTGCACACTCCAGCCTGGG + Intergenic
1063449494 10:6142049-6142071 CAGCCTCCTGACTCCAGCCCAGG + Intergenic
1063685159 10:8229982-8230004 TAGCCACAGCACTCCAGCCAGGG + Intergenic
1064262024 10:13793617-13793639 CAGCCTCCCCACTCCAGCCATGG - Intronic
1065160422 10:22914372-22914394 CACCTTGCTCACTCCAGCCTGGG + Intergenic
1065990319 10:31003199-31003221 TAGCCACCTCACTTCAGCTAAGG + Intronic
1066216010 10:33288327-33288349 TAGCCACTGCACTCCAGCCAAGG - Intronic
1066360684 10:34727404-34727426 TAGCCTTCTCCCTGCAGGCAGGG + Intronic
1066975392 10:42363596-42363618 CAGCCCGCTCACCCCAGCCATGG - Intergenic
1067211185 10:44261373-44261395 TCGCCTGCTCACTGCAGCCTGGG - Intergenic
1069446761 10:68479773-68479795 CAGCCTGGGCACTCCAGCCTGGG + Exonic
1069855350 10:71437645-71437667 TTGCCTGCCCACTCTGGCCATGG + Intronic
1071346182 10:84696262-84696284 GACCCTGCTGACACCAGCCACGG + Intergenic
1072070025 10:91907494-91907516 TAGCCACCGCACTCCAGCCTGGG + Exonic
1072337881 10:94415703-94415725 CAGCCTGGGCACTCCAGCCTGGG + Intronic
1072759861 10:98047588-98047610 TAGCCTGATAACTGCAGCCCTGG + Intergenic
1072930086 10:99654775-99654797 TAGCCACCGCACTCCAGCCTGGG - Intergenic
1073054834 10:100692683-100692705 TAGCCTTTTTACTCCAGCCTGGG + Intergenic
1074882595 10:117670369-117670391 TTGTCTTCTCACTCCAGCCCTGG + Intergenic
1075737157 10:124670946-124670968 TGGCCAGCACACTCCAGGCAAGG + Intronic
1075853938 10:125612126-125612148 TTGCCACCTCACTCCAGCCTGGG - Intronic
1076300418 10:129421501-129421523 CAGCCTGCCCCCTCCAGCCATGG + Intergenic
1076721267 10:132394427-132394449 TGGCCTTTTCACCCCAGCCAGGG + Intergenic
1078213688 11:9293145-9293167 TAGCCTCTGCACTCCAGCCTAGG - Intronic
1080628987 11:34055190-34055212 CAGCCTGGGCACTCCAGCCTGGG - Intronic
1080825061 11:35841355-35841377 TAGCCACCACACTCCAGCCTGGG + Intergenic
1081833821 11:46137039-46137061 CAGCCTGCTCGCCCCAGCCTCGG + Intergenic
1082099409 11:48159722-48159744 TAGCCACCACACTCCAGCCTGGG + Intronic
1082283448 11:50296938-50296960 GCGCCACCTCACTCCAGCCAGGG + Intergenic
1084032446 11:66488892-66488914 TAGCCTGGGCACTCCAGCCTGGG - Intronic
1084878490 11:72152473-72152495 AAGCCACCTCACTCCAGCCTGGG - Intergenic
1085769225 11:79310105-79310127 TAGCCAGCTCAGTCTACCCAGGG + Intronic
1087395053 11:97586441-97586463 TTGCCTGAGCACTCCAGCCTGGG + Intergenic
1089570776 11:119407670-119407692 CAGCCTGGGCACTCCAGCCTGGG - Intergenic
1089812683 11:121144541-121144563 CAGCTTGCTCACTGCAGCAACGG - Intronic
1090050033 11:123369841-123369863 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1092340653 12:7673001-7673023 TAGCCACTTCACTCCAGCCTGGG + Intergenic
1097117359 12:56707408-56707430 TGTACTACTCACTCCAGCCAGGG - Intergenic
1097222323 12:57458600-57458622 TAGCCTCTGCACTCCAGCCTGGG + Intronic
1098870494 12:75812072-75812094 TAGCCACTTCACTCCAGCCCAGG + Intergenic
1101899708 12:108782300-108782322 TAACCTGCTCCCACCAGCCCTGG - Intergenic
1103075179 12:117976154-117976176 TAGCCACCGCACTCCAGCCTGGG + Intergenic
1103829554 12:123767995-123768017 TAGCCTCCTCACTGCAGTCTGGG + Intronic
1105518629 13:21112253-21112275 TAGCCACCACACTCCAGCCTGGG + Intergenic
1106033050 13:26019695-26019717 TAGCCTGCACACGGCCGCCACGG + Intronic
1106132499 13:26951870-26951892 CAGCCTGCTAATTCCAACCAAGG + Intergenic
1106394924 13:29370427-29370449 TAGCCTCTGCACTCCAGCCTGGG + Intronic
1107216182 13:37921744-37921766 TAGCCACCGCACTCCAGCCTGGG - Intergenic
1108488354 13:50952125-50952147 TAGCCACCGCACTCCAGCCTGGG + Intronic
1111327791 13:86722003-86722025 TAGCTGGCTCACACCAGCCATGG + Intergenic
1111750600 13:92326934-92326956 TACACTGGTCACTGCAGCCAAGG - Intronic
1113736167 13:112680318-112680340 TGCCCTGCTCACTGCAGCAAAGG + Intronic
1113966754 13:114157041-114157063 CAGCCTGGGCACTCCAGCCTGGG - Intergenic
1115264651 14:31488432-31488454 TAGCCACCACACTCCAGCCTGGG + Intergenic
1116795431 14:49384824-49384846 TAGGCTGCACACTGCAGCCTTGG - Intergenic
1118268000 14:64313834-64313856 TCGCCACTTCACTCCAGCCAGGG + Intronic
1118320787 14:64752049-64752071 GAGCCAGTTCACTCCAGCCGGGG + Intronic
1118348802 14:64959054-64959076 AAACCAGCTCACTCCAGGCAGGG + Intronic
1118622682 14:67628254-67628276 TAGCCCCCACACTCCAGCCTGGG - Intronic
1118639180 14:67776515-67776537 TAGCCTGCTCACGCCTGGCCTGG + Intronic
1119026333 14:71155831-71155853 TAGGCACCTCACTGCAGCCAGGG + Intergenic
1119186088 14:72643576-72643598 ACCCCTCCTCACTCCAGCCAGGG - Intronic
1119444380 14:74651129-74651151 TAGCCACCACACTCCAGCCTGGG - Intergenic
1120939680 14:89935442-89935464 TAGCCTTTGCACTCCAGCCTGGG - Intronic
1121343669 14:93119661-93119683 TAGCCTCCACACTCCAGCCTGGG + Intergenic
1121565944 14:94909021-94909043 AAGCCTGCTGACTCCAAACATGG + Intergenic
1122476877 14:102016377-102016399 TAGCCGGCTGTCTCCAGACAGGG - Exonic
1124429738 15:29596360-29596382 TAGGCTCCTCACTGCAGGCATGG - Intergenic
1124528822 15:30485003-30485025 TTGCCTCCACACTCCAGCCTGGG - Intergenic
1124769835 15:32522690-32522712 TTGCCTCCACACTCCAGCCTGGG + Intergenic
1126627316 15:50697330-50697352 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1126695326 15:51321089-51321111 CAGCCTGCTTACTTCATCCAGGG + Intronic
1127390873 15:58504141-58504163 GAGCTTGTTCACTCCAGCCAGGG - Intronic
1127438373 15:58981019-58981041 TAGCCACTACACTCCAGCCAGGG - Intronic
1127640937 15:60915200-60915222 TAGCCTGCTCTCCCCAGCATGGG + Intronic
1128016412 15:64351828-64351850 GAGCCTGGGCACTCCAGCCTGGG + Intronic
1129266366 15:74395629-74395651 TAGCCTGCTCACTGGTGCCTGGG - Intergenic
1129650523 15:77484165-77484187 TAGCCACCGCACTCCAGCCTGGG - Exonic
1130094468 15:80845730-80845752 TGGCCTGCCCACTCCATCCCAGG - Intronic
1130344820 15:83033169-83033191 TAGCCACTGCACTCCAGCCAGGG + Intronic
1131013449 15:89038535-89038557 CAGCCTGCTGACCTCAGCCAGGG - Intergenic
1131169272 15:90165385-90165407 TAGCCACCACACTCCAGCCTGGG + Intronic
1132592682 16:733176-733198 GAGCCCCCACACTCCAGCCAGGG + Intronic
1133598059 16:7312047-7312069 TAGGCTGCTCACTGCACCCCAGG - Intronic
1133950955 16:10392094-10392116 TTGCCCGTTCACTCCAGCCTGGG - Intronic
1134232312 16:12438426-12438448 TTACCCGCTCACTCCAGCCCAGG + Intronic
1135236482 16:20761135-20761157 CAGCCTGGGCACTCCAGCCTGGG - Intronic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1137635381 16:49981531-49981553 TAGCCACAGCACTCCAGCCAGGG + Intergenic
1138932861 16:61682578-61682600 TCTCCTGTTCACTACAGCCATGG + Intronic
1139513881 16:67442225-67442247 CAGCCAGCTCGCTCCAACCAGGG + Intronic
1140055947 16:71525907-71525929 CTGCCTGCTCACTCCACCCTGGG - Intronic
1141384216 16:83604307-83604329 CAGACTGCTCACTCTTGCCATGG + Intronic
1141646278 16:85369749-85369771 CAGCCAGCTCAGCCCAGCCAGGG - Intergenic
1141993982 16:87625528-87625550 CAGCATGCACACTGCAGCCAAGG + Intronic
1142505231 17:358908-358930 TCGCCTGCAGACTCCAGCCCCGG + Intronic
1142896124 17:2980319-2980341 AAGCTTGCTCAGTCCAGCCAAGG - Exonic
1143361619 17:6375775-6375797 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1143904161 17:10196651-10196673 CAGCTGGCTCAGTCCAGCCAGGG + Intronic
1145203769 17:20969536-20969558 CAGCTTGCCCACTCCAGCCCAGG - Intergenic
1146151315 17:30475147-30475169 AAGCCTTCTCTCTCCAGACAAGG + Intergenic
1146707054 17:35008474-35008496 TCGCCACCGCACTCCAGCCAGGG - Exonic
1146796047 17:35781901-35781923 TAGCCACTGCACTCCAGCCAGGG - Intronic
1147348076 17:39817468-39817490 TAGCCAGTGCACTCCAGCCTGGG - Intronic
1147891878 17:43723100-43723122 TGGCCTGCTCTCTCCAGCAAAGG - Intergenic
1148872086 17:50664296-50664318 TAGCCACCACACTCCAGCCTGGG + Intronic
1150352216 17:64454258-64454280 TAGCCTCTGCACTCCAGCCTGGG - Intronic
1151197184 17:72439998-72440020 TGTCCTGCTCACGTCAGCCAGGG - Intergenic
1151896062 17:76981735-76981757 CAGCCTGCCCACCCCTGCCATGG + Intergenic
1155129833 18:22922503-22922525 TTGCCACCTCACTCCAGCCTGGG - Intronic
1155144836 18:23074864-23074886 TAGCCACCACACTCCAGCCTGGG - Intergenic
1155555630 18:27016052-27016074 GACCCTGCTCATCCCAGCCATGG + Intronic
1157244529 18:46041587-46041609 TAGCCTGGTCCCTCCAACCTTGG - Intronic
1157288881 18:46395982-46396004 CTGCCTGGTCATTCCAGCCAAGG - Intronic
1157555304 18:48609680-48609702 AAGCCACCTGACTCCAGCCAGGG + Intronic
1157751158 18:50179689-50179711 CAGCCTGCTCTCTAAAGCCATGG + Intronic
1158459055 18:57631895-57631917 TAATCTTCACACTCCAGCCAGGG + Intergenic
1158594359 18:58803286-58803308 TAGCCACCACACTCCAGCCTGGG + Intergenic
1159869586 18:73745186-73745208 TAGCCACCACACTCCAGCCTGGG + Intergenic
1160596086 18:79975443-79975465 TAGGCTGCTCCCGCCACCCAAGG + Intronic
1161344444 19:3761148-3761170 GAGTCTGTTCACTCCAGCCCTGG + Intronic
1161351215 19:3792991-3793013 TAGCTTCCTCCCCCCAGCCAGGG + Intronic
1162674776 19:12290757-12290779 CAGCCTAATCACTCCAGCAATGG - Intronic
1162704826 19:12547650-12547672 CAGCCTTATCACTCCAACCAGGG - Intronic
1163247175 19:16103780-16103802 TGGCCTGTGCACTCCAGCCTGGG + Intergenic
1163742358 19:19023357-19023379 TAGCCACCGCACTCCAGCCTGGG - Intronic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163915048 19:20233833-20233855 CAGCCTGCTCACCCGAGCCATGG - Intergenic
1163933675 19:20422793-20422815 CAGCCTGCTCACCCCAGCTATGG - Intergenic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1163993791 19:21024168-21024190 TAGCCTGCTCACTCTAGCTGTGG + Intronic
1163999662 19:21085694-21085716 CAGTCTGCTCACCCCAGCCATGG + Intronic
1164005585 19:21145546-21145568 CAGTCTGCTCAACCCAGCCATGG + Intronic
1164027175 19:21363409-21363431 TAGCCTGCTCACTCCAGTCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164042917 19:21509599-21509621 CTGCCTGCTCACCCCAGCCATGG + Intronic
1164053270 19:21600995-21601017 TAGCCTGCTCACAATAGCCATGG - Intergenic
1164070537 19:21764093-21764115 CAGCCTTCTCACTGCAGCCATGG - Intronic
1164095529 19:22006596-22006618 CAGCCTGCTTACCGCAGCCATGG - Intronic
1164114998 19:22211281-22211303 CAGCCTGCTTACCGCAGCCATGG - Intergenic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164176518 19:22780077-22780099 CAGCCTGCTCACCCCAGTCATGG - Intronic
1164183020 19:22836184-22836206 CAGCCTGCTCACCCTAGCCATGG + Intergenic
1164198806 19:22999446-22999468 CAGCCTGCTTACCCCAGCCATGG - Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164228578 19:23267853-23267875 TGGCCTGCTCACAATAGCCATGG - Intergenic
1164243547 19:23410834-23410856 TGGCCTGCTCACAATAGCCATGG - Intergenic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164309621 19:24034287-24034309 CAGCCTGCTCACAATAGCCATGG + Intronic
1164449098 19:28344486-28344508 GAGCCGCCTCACTCCAGACATGG + Intergenic
1166717251 19:44976451-44976473 TAGCCAGTGCACTCCAGCCTGGG + Intronic
1168219236 19:54948505-54948527 TGGCCATCTCACTCCAGCCTAGG + Intronic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
927134795 2:20088906-20088928 TAGCCTCCTTTCTCCAGCCATGG + Intergenic
930004357 2:46884109-46884131 TAGGCTGGTATCTCCAGCCATGG - Intergenic
930025685 2:47027952-47027974 TGGCCTGCGCACTCCTGACAGGG - Intronic
931844766 2:66192059-66192081 TAGCCAGTACACTCCAGCCTGGG - Intergenic
932438279 2:71716056-71716078 GACCCTGATGACTCCAGCCAAGG + Intergenic
935555885 2:104508953-104508975 TAGGCTGCTCTCTCCAGCCAGGG + Intergenic
935658372 2:105443999-105444021 GACCCAGCTCCCTCCAGCCAGGG - Intergenic
938605839 2:132891773-132891795 TTGCCTTCGCACTCCAGGCATGG - Intronic
940743828 2:157544503-157544525 CAGCTTGATCATTCCAGCCACGG + Exonic
941803353 2:169686048-169686070 TAGCCACTGCACTCCAGCCAGGG - Intronic
943159151 2:184224644-184224666 TAGCCTGCTCATTCTAGAAAGGG - Intergenic
943275606 2:185863789-185863811 TAGCCTCCTCCCTCCAGGAAAGG + Intergenic
944494346 2:200291210-200291232 CAGCCTGCTCAGTTCAGCCCAGG - Intergenic
1168976442 20:1969632-1969654 CAGCCCCCTCACTCCCGCCAAGG + Intergenic
1169350432 20:4863935-4863957 TAGCCTGCTGTCACCAGTCATGG + Intronic
1172992308 20:39045615-39045637 TGGCCGACTCACTCCATCCAGGG - Intergenic
1174318577 20:49722202-49722224 TAGCCACCGCACTCCAGCCTAGG + Intergenic
1174321280 20:49743553-49743575 GAGCCACCTCACTCCAGCCTGGG - Intergenic
1174425475 20:50429213-50429235 TAGCCAGAACACTCCAGCCTGGG - Intergenic
1175788754 20:61728441-61728463 TTTCCTGCTCATTCCAGACATGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177838952 21:26215412-26215434 GAGCCACCTCACTCCAGCCTGGG + Intergenic
1178166707 21:29986000-29986022 CAGCATGCCCACTCCAGCCATGG + Intergenic
1178919781 21:36731157-36731179 TAGCACGCCCACCCCAGCCACGG + Intronic
1179446913 21:41438434-41438456 AGGCCCGGTCACTCCAGCCAAGG - Intronic
1179519175 21:41931198-41931220 GAGCCTGCTCACAGCAGCCGTGG + Intronic
1179660132 21:42869003-42869025 TAGCCTGTTCCCCCCCGCCAGGG - Intronic
1181175913 22:21035393-21035415 TAGCCTCTTCACTCCAGCCTGGG + Intergenic
1181746058 22:24955653-24955675 CAGCCTCCCCACACCAGCCAGGG - Intronic
1182154454 22:28056176-28056198 TAGCCACTGCACTCCAGCCATGG - Intronic
1183937727 22:41273171-41273193 TTGCCTGCTCACAGCAACCAGGG - Intronic
1184214919 22:43060275-43060297 TAGGCAGCTCCCTCAAGCCAAGG - Intronic
1184926279 22:47642057-47642079 AAGCCTGCTCGCTCTAGCCAAGG + Intergenic
950070045 3:10144537-10144559 CAGCCTCCACACTCCAGCCCAGG - Intronic
950154114 3:10709048-10709070 TGGCCTGCTCTCTGCAGCCCTGG + Intergenic
950268856 3:11596963-11596985 TAGCCTACCTGCTCCAGCCATGG - Intronic
950310367 3:11952811-11952833 TAGCCAGTCCACTCCAGCCTGGG - Intergenic
951520243 3:23604643-23604665 TCACCTGCTTCCTCCAGCCAAGG - Intergenic
952131573 3:30370278-30370300 TTGCCAGGTAACTCCAGCCATGG - Intergenic
952170984 3:30806806-30806828 TAGCCTGAACTCTCCAGCTATGG - Intronic
954731252 3:52664188-52664210 TAGCCAGTGCACTCCAGCCTGGG + Intronic
955981348 3:64530569-64530591 TACCCAGCTCCCTCCAGCCCAGG + Intronic
959056335 3:101571453-101571475 TAGCCACCACACTCCAGCCTGGG + Intergenic
960405439 3:117253681-117253703 AAGCCTCCTCCCTCCAGCCATGG - Intergenic
961796451 3:129412348-129412370 TAGCCACTTCACTCCAGCCTAGG + Intronic
964746140 3:160014381-160014403 GAGCCACATCACTCCAGCCAAGG - Intergenic
965776540 3:172237552-172237574 TAGCCATCACACTCCAGCCTGGG + Intronic
968117561 3:196101222-196101244 CAGCCTGGGCACTCCAGCCTGGG - Intergenic
971775340 4:30956183-30956205 CAGCCTGGGCACTCCAGCCTGGG + Intronic
972301430 4:37789007-37789029 TGGACTTCTCTCTCCAGCCAAGG + Intergenic
973621848 4:52734921-52734943 TGGCCATTTCACTCCAGCCAGGG - Intronic
975473467 4:74795165-74795187 GAGCCACTTCACTCCAGCCAAGG + Intergenic
976053101 4:81031283-81031305 CAGCCTGCTCGCCCCAGCCATGG - Exonic
976267630 4:83199507-83199529 TAGCCACCGCACTCCAGCCTAGG - Intergenic
976559604 4:86486254-86486276 TAGCCACTGCACTCCAGCCAGGG + Intronic
977133582 4:93272712-93272734 CAGTCTTCTCACTCCTGCCATGG - Intronic
979500509 4:121434580-121434602 TGTCCTAGTCACTCCAGCCATGG - Intergenic
981631770 4:146827146-146827168 GAGCCCCCTCCCTCCAGCCAAGG - Intronic
983503175 4:168523657-168523679 AAGCCTGGTCACTCCAGTCCAGG + Intronic
983660429 4:170126100-170126122 TGGCCTAGCCACTCCAGCCATGG + Intergenic
984865776 4:184279188-184279210 TAGCCACCACACTCCAGCCTGGG + Intergenic
985717694 5:1471874-1471896 TCTCTTGCTCTCTCCAGCCAGGG - Intronic
986006407 5:3672414-3672436 CTCCCTGCACACTCCAGCCATGG - Intergenic
987576406 5:19733947-19733969 TTACATGCTCACTCCTGCCAGGG + Intronic
989037905 5:37194699-37194721 TAGCCACCGCACTCCAGCCTGGG - Intronic
992291885 5:75287912-75287934 ATGCCAGCTCACTCCAGCCCGGG - Intergenic
992684813 5:79188962-79188984 TAGGCTGCCCACTCCAGCCTGGG - Intronic
995152295 5:108863160-108863182 AAGCCTCTTCACTCCAGCCTGGG - Intronic
995395314 5:111681139-111681161 TTGCTTGCTCACTCCAGGAAGGG - Intronic
996429038 5:123350244-123350266 TAGCCAGTGCACTCCAGCCTGGG - Intronic
997462837 5:134066147-134066169 TAGCCAGCACTCTCCAGCCTGGG - Intergenic
997996616 5:138591677-138591699 TAGCCACCACACTCCAGCCTGGG + Intergenic
998233044 5:140373744-140373766 TAGCCAGTGCACTCCAGCCTGGG + Intronic
999782734 5:154863459-154863481 TAGCCACCGCACTCCAGCCTGGG - Intronic
1001846842 5:174929709-174929731 TCACCAGCTCACTCCAGCCTGGG - Intergenic
1002322222 5:178382823-178382845 CAGCCTTCTGACTCCTGCCAAGG - Intronic
1003874812 6:10426069-10426091 TAGCCTTCTCACCCGAGGCAAGG - Intergenic
1004718464 6:18242542-18242564 CATCCTGCTCACTCCTGCCCGGG + Intronic
1007090913 6:39184434-39184456 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1007354753 6:41306037-41306059 TTGCCACCTCACTCCAGCCTGGG - Intergenic
1008613070 6:53201999-53202021 TAGCCAGCACACTCCAACCGGGG - Intergenic
1009297815 6:61976061-61976083 TGGCCAGGTCACACCAGCCATGG + Intronic
1009720397 6:67461198-67461220 TAGCCTGGTAGCTCCAGCCATGG - Intergenic
1010767600 6:79794066-79794088 CAGGCTGCTCTGTCCAGCCATGG - Intergenic
1010915639 6:81614537-81614559 AAGCCTGCTCACTGCAGCTGGGG + Intronic
1011032496 6:82939009-82939031 TACACTCCACACTCCAGCCAAGG + Intronic
1011523028 6:88230784-88230806 TAGCCAGTACACTCCAGCCTGGG + Intergenic
1012111734 6:95243785-95243807 GAGCCTGCTCACTGCAGAGATGG - Intergenic
1012998838 6:106000414-106000436 TAGCCACTTCACTCCAGCCTGGG + Intergenic
1015296775 6:131603889-131603911 TATCCTGCTCACTGCATCCCAGG + Intronic
1018446679 6:163864835-163864857 ATGCCACCTCACTCCAGCCAGGG - Intergenic
1019206690 6:170367555-170367577 TTACCTGCTGGCTCCAGCCAAGG - Intronic
1019422841 7:958990-959012 TGGCCTGACCACTCCAGTCACGG + Intronic
1023286329 7:38624523-38624545 TATCCTGCTCACTACAGTCATGG + Intronic
1023399390 7:39780905-39780927 TAGCCTGGGCAATCCAGCCTGGG - Intergenic
1023417811 7:39949531-39949553 TGGCGTGCTCGCTCCCGCCAGGG - Intergenic
1023827168 7:44017365-44017387 AGGACTGCACACTCCAGCCAGGG - Intergenic
1023830770 7:44037920-44037942 TAGCCTGCTCTCACCTGCCCAGG + Intergenic
1024783250 7:52876146-52876168 CAGCCTGTTCACTCCAGACAAGG - Intergenic
1025024109 7:55502154-55502176 TAGTCTGCTCTCTCCAGCATGGG - Intronic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025281873 7:57632368-57632390 TAGACCTCACACTCCAGCCAGGG - Intergenic
1025302856 7:57833149-57833171 TAGACCTCACACTCCAGCCAGGG + Intergenic
1025719039 7:63992571-63992593 CAACCTGCTCACCCCAGCCATGG + Intergenic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1025778833 7:64581584-64581606 CAGCTTGCTCACACCAGCCGTGG + Intergenic
1025788968 7:64669993-64670015 TCCCCTGCTCACCCCAGCCATGG + Intronic
1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG + Intergenic
1025802271 7:64797574-64797596 GAGCCTGCTCACCCCAGCCATGG + Intronic
1025824935 7:65003122-65003144 CAGCCTGCTCACTCTAGCCATGG - Intronic
1026480392 7:70773828-70773850 CAGCTTGCTCTCTCCAGCAATGG - Intronic
1027856271 7:83515640-83515662 TAGACTGCTCACCTCAGCAATGG + Intronic
1028130324 7:87164010-87164032 TAGCCTCTGCACTCCAGCCTGGG + Intronic
1028328118 7:89551957-89551979 TAGCCTCTGCACTCCAGCCTAGG + Intergenic
1029411847 7:100417925-100417947 TCGCCACCTCACTCCAGCCTGGG - Intronic
1029477437 7:100793298-100793320 CAGCCTGGGCACTCCAGCCTGGG + Intronic
1029738320 7:102477111-102477133 AGGACTGCACACTCCAGCCAGGG - Intronic
1029755450 7:102570767-102570789 AGGACTGCACACTCCAGCCAGGG - Intronic
1029773399 7:102669847-102669869 AGGACTGCACACTCCAGCCAGGG - Intronic
1033236777 7:139644388-139644410 CAGCCTGCACACTCAAGCCTGGG + Intronic
1033402875 7:141043494-141043516 TAGGAAGCTCACTCCAGCCTGGG + Intergenic
1035464468 7:159065440-159065462 CAGCCTCCACTCTCCAGCCACGG - Intronic
1035581929 8:745982-746004 CGGCCTGCTCAGGCCAGCCAAGG + Intergenic
1036065970 8:5381843-5381865 TTCCCTGCTCACTCCACCCCAGG + Intergenic
1037486894 8:19356486-19356508 TAGGCTCTGCACTCCAGCCAGGG + Intronic
1037944429 8:22978082-22978104 TAGCCACCACACTCCAGCCTGGG + Intronic
1038454116 8:27661067-27661089 GAGCCTGCTCACGCCAGGGAGGG + Intronic
1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG + Intergenic
1041625094 8:60016191-60016213 TGACCTGCTCAACCCAGCCAGGG + Intergenic
1042178527 8:66061247-66061269 TAGCCACCGCACTCCAGCCTGGG + Intronic
1042599080 8:70480215-70480237 TAGCCACTTCACTCCAGCCTGGG - Intergenic
1042798951 8:72696610-72696632 CAGGCTGCTCTCTCCATCCACGG - Intronic
1043077085 8:75715801-75715823 TTGCATGCCCGCTCCAGCCAGGG + Intergenic
1044333156 8:90945104-90945126 AAGCCTGGGCACTCCAGCCTGGG - Intronic
1044668639 8:94656162-94656184 TAGCCACCACACTCCAGCCTAGG + Intronic
1045046656 8:98285380-98285402 AAGCCTGGTAACTCCAGCCTTGG + Intronic
1045583607 8:103504892-103504914 TCGCCATCTCACTCCAGCCTGGG - Intronic
1047279083 8:123429538-123429560 TAGCCACTGCACTCCAGCCAGGG + Intronic
1047568259 8:126070118-126070140 AATCCTGCTCACTCTAGCCCTGG - Intergenic
1047836187 8:128695734-128695756 AAGCCTGATCTCTCTAGCCAAGG - Intergenic
1049367488 8:142247608-142247630 TAGCCACCCCACTCCAGCCTGGG - Intronic
1050296267 9:4208522-4208544 AATCCTGCCCACTCCAGCAATGG - Intronic
1050735792 9:8761468-8761490 TTGCTTGCTCTCTCCATCCATGG - Intronic
1055720293 9:79165682-79165704 TAGCCTCCTAACTCCAACCAAGG + Intergenic
1056013537 9:82357619-82357641 CAGCCACCTCACTCCAGCCTGGG + Intergenic
1056279466 9:85027193-85027215 TAGCCAGTGCACTCCAGCCTGGG - Intergenic
1056412587 9:86345916-86345938 TAGCCAGTTCACTCCAGCCAGGG - Intronic
1057557364 9:96098601-96098623 GACCCTGCTCACTGCAGCCTTGG - Intergenic
1057882521 9:98803233-98803255 TAGCCTCTACACTCCAGCCTGGG - Intergenic
1059181793 9:112221943-112221965 TAGCCACTTCACTCCAGCCCTGG - Exonic
1059506230 9:114802293-114802315 ACGCCAGCTCACTCCAGCCTGGG - Intronic
1060145101 9:121245782-121245804 TAGCCTCTGCACTCCAGCCTGGG - Intronic
1061265634 9:129503344-129503366 TAGCCACTGCACTCCAGCCAGGG - Intergenic
1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG + Intronic
1186384543 X:9095422-9095444 TAGCATGCTCAGCACAGCCAAGG + Intronic
1186478695 X:9879102-9879124 TAGCCACCGCACTCCAGCCTGGG - Intronic
1186780735 X:12909580-12909602 TAGCCTGCTCAGTGCAGAAAGGG + Intronic
1187460304 X:19480775-19480797 GAGCCTGTGCACTCCAGCCTGGG + Intronic
1189142479 X:38621099-38621121 AAGCCTTCTCACTCAAGACATGG - Intronic
1190991109 X:55551629-55551651 AAACCTGCTTACTCTAGCCAAGG + Intergenic
1191860922 X:65666367-65666389 GAGCCAGTGCACTCCAGCCAGGG - Intronic
1192316656 X:70057365-70057387 AAGCCTGTTTTCTCCAGCCAAGG + Intergenic
1194721138 X:97341299-97341321 TAGCCACCACACTCCAGCCTTGG + Intronic
1195161249 X:102173882-102173904 TAGCCAGTGCACTCCAGCCTGGG + Intergenic
1196088859 X:111716975-111716997 TAGCCACCACACTCCAGCCTAGG - Intronic
1196691481 X:118563412-118563434 TAGCCAGTGCACTCCAGCCTGGG + Intronic
1196798667 X:119522905-119522927 AAGCGTGGTCACTCCCGCCAGGG + Intergenic
1197189703 X:123632396-123632418 TAGACTGATCACTTGAGCCAGGG + Intronic
1197216490 X:123871557-123871579 GAGCCTGGCCACTCCAGCCTGGG - Intronic
1197246938 X:124175912-124175934 TAGCCATCGCACTCCAGCCTGGG + Intronic
1197247264 X:124178818-124178840 TAGCCATCACACTCCAGCCTGGG - Intronic
1200965944 Y:9038486-9038508 ATGCCTGTGCACTCCAGCCAGGG - Intergenic
1201303164 Y:12527643-12527665 TAGCCACCACACTCCAGCCTGGG - Intergenic