ID: 1164225937

View in Genome Browser
Species Human (GRCh38)
Location 19:23245992-23246014
Sequence AGCAGGCTAGGAAATCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 1, 2: 9, 3: 32, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164225929_1164225937 30 Left 1164225929 19:23245939-23245961 CCATGGCTCTATAGCTTCTCTTC 0: 1
1: 0
2: 1
3: 25
4: 280
Right 1164225937 19:23245992-23246014 AGCAGGCTAGGAAATCTGCAGGG 0: 1
1: 1
2: 9
3: 32
4: 251
1164225934_1164225937 -9 Left 1164225934 19:23245978-23246000 CCATGGCTGGAGTGAGCAGGCTA 0: 1
1: 3
2: 8
3: 42
4: 309
Right 1164225937 19:23245992-23246014 AGCAGGCTAGGAAATCTGCAGGG 0: 1
1: 1
2: 9
3: 32
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164225937 Original CRISPR AGCAGGCTAGGAAATCTGCA GGG Intronic
902540079 1:17148245-17148267 AGGAGGCTAGGAAATCAGAGTGG + Intergenic
902801600 1:18833458-18833480 AGCAGGCCAGGAAATAGGGAAGG - Intergenic
904916056 1:33971416-33971438 CACAGGCTGGGAGATCTGCAGGG + Intronic
906242668 1:44251585-44251607 AGGAGGCTAGGAAAGCTTCCTGG + Intronic
906712976 1:47945382-47945404 AGCAGGCTAGTAAAGCTTTAAGG - Intronic
909547375 1:76862850-76862872 AGGAGGGGAGGAAAACTGCAAGG - Intergenic
909715603 1:78702743-78702765 AGGAAGCTGGGAACTCTGCATGG - Intergenic
909728606 1:78866792-78866814 AGCAGGCTAGGAAATTAGGCAGG - Intergenic
910163042 1:84294368-84294390 AGGAGGAAAGGAAAGCTGCAGGG - Intergenic
910300626 1:85703211-85703233 AGCAAGCTAGGAAACTTGTATGG + Intronic
910384329 1:86664949-86664971 AGCAGGTTATGAATTCTGCCAGG - Intergenic
910776618 1:90882944-90882966 AGCAGGCTGAGAAATCTACTTGG + Intergenic
911255644 1:95629960-95629982 AGTAGGCAAGGTACTCTGCAAGG - Intergenic
911310816 1:96289747-96289769 AGAAAGCTGGGAACTCTGCATGG - Intergenic
911460553 1:98183736-98183758 ACCAGGTAAGGAATTCTGCAGGG - Intergenic
912234452 1:107834765-107834787 AGGAAGCTGGGAACTCTGCATGG + Intronic
912552745 1:110494689-110494711 AGCATTCTAGGAACTCTGCTGGG - Intergenic
914344322 1:146785446-146785468 TGCAGGCAAAGAACTCTGCATGG - Intergenic
917602983 1:176595915-176595937 AGGAGGCCAGGAAATCTTCATGG + Intronic
918950058 1:191125715-191125737 AGGAAGCCAGGAACTCTGCATGG + Intergenic
919172365 1:193971257-193971279 AGCAGGAAAGGAAATATGCAAGG - Intergenic
919985789 1:202673706-202673728 AACAGAGTAGTAAATCTGCAAGG - Intronic
921216506 1:212942174-212942196 AGAAGGCTACGAAATTTGTAAGG + Intergenic
921368709 1:214400196-214400218 AGCAGACAAGAAAATATGCAGGG - Intronic
921570482 1:216772253-216772275 AGCTGGCTGCAAAATCTGCATGG + Intronic
922996289 1:229964366-229964388 AGCAGGCCCTCAAATCTGCATGG - Intergenic
924390174 1:243546149-243546171 AGCAGGCAAGGGCATGTGCAGGG - Intronic
924787009 1:247208209-247208231 TGCAGGCTGGGACACCTGCAGGG + Intergenic
1063859137 10:10289578-10289600 AACAAGCAAGGAAATCTCCAAGG - Intergenic
1064289870 10:14023716-14023738 TGCAGGCTTTGAAAACTGCAGGG - Intronic
1065613317 10:27494714-27494736 AGCAGCCTAAGAAATCTCGATGG - Intergenic
1066710420 10:38227554-38227576 AGCAGGCTGGGACAGCTGCAGGG - Intergenic
1066979586 10:42399894-42399916 AGCAGGCTGGGATAGCTCCAGGG + Intergenic
1070320658 10:75352369-75352391 AACAGGCTAGGAGATCTTCTGGG - Intergenic
1070845465 10:79519367-79519389 AGCAACCTTGGAAATCTGCATGG + Intergenic
1070928328 10:80240947-80240969 AGCAACCTTGGAAATCTGCATGG - Intergenic
1071330452 10:84553678-84553700 GGGAGGCTAGGAAATATCCATGG - Intergenic
1071388820 10:85149396-85149418 AGCAGGATGGGAAATTGGCAAGG - Intergenic
1072680234 10:97500378-97500400 AGCAGGGAAGGATGTCTGCATGG + Intronic
1073305046 10:102496307-102496329 TCCAGGCTGGGAAATCTGAAAGG - Intronic
1073860532 10:107732848-107732870 AGGAAGCTAGGAAATCTGCATGG - Intergenic
1075123669 10:119682547-119682569 AGCAGGCTAGAAACTCAGCCAGG - Intergenic
1076066852 10:127455607-127455629 AGCAGGCTAGGAAGTCAGGCAGG - Intergenic
1077909121 11:6558798-6558820 AGAAGGGTAGGAAATGTGAAGGG - Intronic
1080133602 11:28826562-28826584 TGCAGGCTAGGAAATCTTGTGGG - Intergenic
1081716812 11:45256303-45256325 ATCAAGCTAGGCAAGCTGCAAGG - Intronic
1082665404 11:55970634-55970656 AGAAGGAAAGGAATTCTGCATGG + Intergenic
1083285776 11:61657947-61657969 AGGAGTCTGGGAAATCTGCAAGG - Intergenic
1083384272 11:62296077-62296099 CGCAGGATGGGAAATCTGTAAGG + Intergenic
1084415125 11:69027620-69027642 AGAAACCTAGGAAATCTGTAGGG - Intergenic
1086889230 11:92237265-92237287 AGCCTGCCCGGAAATCTGCATGG - Intergenic
1087135238 11:94709918-94709940 ATAAGGCCAGGAAATATGCAAGG - Intronic
1087386843 11:97482771-97482793 AGCTGGCAAGGAAATCTACCTGG + Intergenic
1088553612 11:111039038-111039060 GGAAGGCTAAGAAATCTGTATGG + Intergenic
1089024458 11:115254705-115254727 AGAAGGAGAGGAAATCTGAAAGG + Intronic
1089711092 11:120315228-120315250 TGTAGGCTAGGAAATCACCAAGG + Intronic
1091590557 12:1840497-1840519 GAGAGGCTAGGAGATCTGCACGG - Intronic
1093546739 12:20357461-20357483 GCCAGGATAGGAAAGCTGCAGGG + Intergenic
1094526163 12:31232578-31232600 AGCAGGCGGGGAAAGATGCAGGG + Intergenic
1094806091 12:34093970-34093992 AGCAGGCTAGAAATTCTGTCAGG + Intergenic
1097057143 12:56257148-56257170 ATCAGGCCAGGAAATCTGAATGG + Intronic
1099325997 12:81215134-81215156 AGCAAGGGAGGACATCTGCATGG - Intronic
1099842417 12:87982483-87982505 AGTAGGTTTGGAAATCTACAGGG - Intronic
1101275733 12:103198772-103198794 AGGAAGCTAGGAACCCTGCATGG - Intergenic
1102647795 12:114414887-114414909 AGCAGGCTGAGAAATCTGGGAGG - Intergenic
1103170773 12:118817564-118817586 AGCTGGATAAGAAATATGCATGG - Intergenic
1105700554 13:22932939-22932961 AGCAGTCAAGGAAAGCTGCCTGG - Intergenic
1105853322 13:24354988-24355010 AGCAGTCAAGGAAAGCTGCCTGG - Intergenic
1106048546 13:26168606-26168628 AGCTGGCTATGAACTATGCAAGG - Intronic
1106307691 13:28528041-28528063 AGCATGCTAAGAAATCTGGGTGG + Intergenic
1107421754 13:40253881-40253903 AGCAGGCTACAGAATTTGCAGGG - Intergenic
1108581403 13:51831474-51831496 AGCTGGCTAGAGAATCTTCAGGG + Intergenic
1109988957 13:70028522-70028544 AGCAGTCTAGGAATTCTGCCTGG + Intronic
1110976580 13:81843526-81843548 AGCAGGCAAGGAAGACTTCAAGG - Intergenic
1111372496 13:87335645-87335667 AGCAAGCAAGGAAATCTCCAAGG + Intergenic
1112409747 13:99152802-99152824 ATCAGGCTGTGAAAGCTGCAAGG + Intergenic
1112478310 13:99752268-99752290 GGCAGGCTAGGGAATGTTCAAGG - Intronic
1114537813 14:23433904-23433926 AGCAGCCTAGCAAACCTGCCAGG + Intronic
1114992891 14:28310535-28310557 AGTTGGGTAGGAAAACTGCAAGG - Intergenic
1116649133 14:47566736-47566758 AGGAAGCTGGGAACTCTGCAAGG - Intronic
1116787978 14:49309105-49309127 AGCAGGAGAGGAAATTGGCATGG + Intergenic
1120563566 14:86026940-86026962 AGCAGGCAAACAATTCTGCAAGG + Intergenic
1120868376 14:89315645-89315667 GGCAGGCTGAGAAAACTGCAGGG + Intronic
1121184363 14:91953700-91953722 AGCAGGCTTGGTAAACTGGAAGG - Intergenic
1121250319 14:92494642-92494664 AGCAGGCTATGAAATTTGTTGGG - Exonic
1122842080 14:104470884-104470906 AGCAGTCAAGGAAAGCTGCCTGG - Intergenic
1202883862 14_KI270722v1_random:85817-85839 ATCAGTCTAGGAGAACTGCAGGG - Intergenic
1124251714 15:28110669-28110691 AACAGGCTAGGAAAACTGGCTGG - Intergenic
1125833514 15:42732111-42732133 AGCAGGCTAGAGGAGCTGCAGGG + Intronic
1126131411 15:45345105-45345127 GGCAGGCTAGGAACTCTGGCAGG - Intergenic
1126206699 15:46053531-46053553 AGAAGGCTGGGAACCCTGCATGG - Intergenic
1126396669 15:48225714-48225736 AGTTGGCTAGGAAATCACCATGG - Intronic
1127976114 15:63998471-63998493 TGCAGGCTGGGGACTCTGCAGGG + Intronic
1129468359 15:75736943-75736965 AGCAGTCTAGGAGAGCTTCAAGG - Intergenic
1130938722 15:88490573-88490595 AGCAACCTAGGGCATCTGCAGGG + Intergenic
1131013992 15:89042500-89042522 ACCAGGACAGGAAATCTTCATGG - Intergenic
1136673288 16:31876878-31876900 AGCAGGCTGGGAAACCTGCAGGG - Intronic
1138729921 16:59183258-59183280 AGGAAGCTGGGAAACCTGCATGG - Intergenic
1139104261 16:63807543-63807565 AGCAGGCAAGCAATTCTGGAAGG - Intergenic
1139933014 16:70544916-70544938 TGGAGGCTAGGAAATCTATATGG + Intronic
1139989675 16:70929903-70929925 TGCAGGCAAAGAACTCTGCATGG + Intronic
1142281189 16:89148528-89148550 AGCAGCCTATGAAAGCAGCATGG - Intronic
1143611134 17:8018138-8018160 AGCAGGCTAGGAAACCACCTAGG + Intronic
1144366667 17:14551176-14551198 AGCAGGCGAGGAAATCAACAAGG + Intergenic
1144710837 17:17400627-17400649 AGGAGGCAAGGAAAGCTGGAGGG - Intergenic
1148428186 17:47619067-47619089 AGCATGGTAGGAAAGCTGCTTGG + Exonic
1149033301 17:52107283-52107305 AGGAGGGTATGAAATCTCCAGGG + Intronic
1149040519 17:52182822-52182844 AGCAGGCTCTGAAATGTGCCAGG - Intergenic
1149123306 17:53196440-53196462 AGGAAGCTGGGAACTCTGCATGG + Intergenic
1151012902 17:70521781-70521803 GGCATGCTAGAAAATCTGCCAGG - Intergenic
1152221579 17:79071369-79071391 AGCAGGCTTGGAAACCAGCCTGG - Intergenic
1152515913 17:80824900-80824922 AGCAGGCGAGGACAGGTGCAGGG + Intronic
1153792824 18:8595500-8595522 TGCCGGCTCTGAAATCTGCAGGG + Intergenic
1154311406 18:13269620-13269642 AGCAGGCTGGGAAACAGGCACGG - Intronic
1157649906 18:49317775-49317797 AGCAGTCTTGAAAATCTGGATGG - Intronic
1158083077 18:53617007-53617029 AGCAGCCTGGGACATCTGGAGGG - Intergenic
1158201236 18:54943397-54943419 AGAAGGGTAGGAAATATGAATGG + Intronic
1158611408 18:58944038-58944060 AGCAGACTAGATAATCTGCTTGG - Intronic
1160241112 18:77123944-77123966 AGCAGCCTAGGGCACCTGCACGG + Intronic
1161255247 19:3305235-3305257 TGCAGGCTAGAAAGTTTGCACGG - Intergenic
1163870540 19:19817611-19817633 AGCAGGCTGAGACAGCTGCAGGG + Intronic
1163879193 19:19902603-19902625 AATAGGCTGGGACATCTGCAGGG - Intronic
1163905111 19:20145363-20145385 AGCAGGCTGAGACAGCTGCATGG + Intergenic
1163928019 19:20363727-20363749 GGTAAGCAAGGAAATCTGCAGGG - Intergenic
1163933679 19:20422807-20422829 AGCAGGCTGGGACATCTGCAGGG + Intergenic
1163939843 19:20481476-20481498 CGCAGGCTGGGACATCTGCAGGG - Intergenic
1163948556 19:20563271-20563293 AGCAGGCTGGGACATGTGCAGGG + Intronic
1163958977 19:20669484-20669506 AGCAGGCTGACACATCTGCAGGG - Intronic
1163983835 19:20926634-20926656 AGCAGGCTGGGACATCTGCAGGG - Intronic
1163993788 19:21024154-21024176 AGCAGGCTAGGACATCTGCAGGG - Intronic
1164005581 19:21145532-21145554 AGCAGACTGGGACATCTGCAGGG - Intronic
1164030641 19:21400630-21400652 AGCAGGCTGGAACATCTGCAGGG - Intronic
1164042913 19:21509585-21509607 AGCAGGCAGGGACACCTGCAGGG - Intronic
1164048674 19:21565037-21565059 AGCAGGCTGGGACTTCTGCAGGG + Intergenic
1164053274 19:21601009-21601031 AGCAGGCTAGGGCATCTGCAGGG + Intergenic
1164225937 19:23245992-23246014 AGCAGGCTAGGAAATCTGCAGGG + Intronic
1164228580 19:23267867-23267889 AGCAGGCCAGAACATCTGCAGGG + Intergenic
1164241306 19:23391772-23391794 AGCAAGCTGGGACATCTGCAGGG + Intronic
1164243550 19:23410848-23410870 AGCAGGCCAGGACATCTGCAGGG + Intergenic
1164283815 19:23792317-23792339 ATCAGGTTGGGAAATTTGCAGGG - Intronic
1164306637 19:24009701-24009723 AGCAGGCTGGGACACCTGCAGGG + Intergenic
1164646699 19:29863638-29863660 AGGAGACCAGGAATTCTGCAGGG - Intergenic
1166286859 19:41836386-41836408 AGCAGGGACAGAAATCTGCAGGG + Intergenic
1166704819 19:44902960-44902982 AGGTGGCCAGGAACTCTGCATGG + Intronic
1168438156 19:56338791-56338813 AGCAGGATGGGAAAGCTACAAGG - Intronic
925730120 2:6913905-6913927 AGCAGGCAAGAACATTTGCAGGG + Intergenic
928113486 2:28528451-28528473 AGCAGGGTGGGAAAGCTCCAGGG - Intronic
929369436 2:41204456-41204478 CCAAGGCTAGGAAATCTTCATGG + Intergenic
933572535 2:84030158-84030180 AGGAGGTTAGAAAGTCTGCAAGG + Intergenic
937234830 2:120424495-120424517 AGCAGCCGAGGAAGCCTGCATGG + Intergenic
937509704 2:122581289-122581311 AGCAGGTTAGTAAATCAACAAGG + Intergenic
939199798 2:139018990-139019012 AGGAAGCTGGGAACTCTGCATGG - Intergenic
939432089 2:142123342-142123364 AGCAGTCTTGGAAATCTTGAAGG + Intronic
941245071 2:163086015-163086037 AGGGGGCTAGGAAATGTGCTGGG - Intergenic
941554045 2:166953399-166953421 AGCAGGCAAGGGCATGTGCAGGG - Intronic
941681259 2:168401771-168401793 AGGAAGCTGGGAATTCTGCATGG - Intergenic
942585651 2:177473814-177473836 AGCCAGCTAGGAATTCTGCATGG - Intronic
942607135 2:177704426-177704448 GGCAGTCTAGAAAATCTGCCAGG - Intronic
945400581 2:209377606-209377628 ATCAGGCTGGGAAGTCAGCATGG - Intergenic
945875250 2:215271701-215271723 AGCAGCCCAGGCAATCTGGAAGG + Intergenic
945979923 2:216301186-216301208 AGCAGGTTAGGGAAGCTCCAAGG + Intronic
946611195 2:221459673-221459695 AGGAGGCTAAGAAAACTGCCTGG + Intronic
946708496 2:222482914-222482936 CTGAAGCTAGGAAATCTGCAGGG - Intronic
948098654 2:235356812-235356834 TGCAGGCAAGGAAATCAGCAAGG + Intergenic
1168775522 20:444182-444204 AGCAGGCTAGGAAAAGGGAATGG + Intronic
1170849699 20:19993685-19993707 AGCAGGCAAGAAAAGCTCCAGGG - Intronic
1171069321 20:22051052-22051074 AGCAGTGTAAGAATTCTGCATGG - Intergenic
1172091125 20:32433708-32433730 GGCAGGCTAGGAATTCTGTCTGG - Exonic
1172787873 20:37481090-37481112 AGCAGGGTAAAAAATCTGAATGG - Intergenic
1174933930 20:54846478-54846500 AGCAGGCAGGGAAATGTGGAAGG - Intergenic
1175776103 20:61654708-61654730 AGCAGGATACGAATTCTGTAGGG + Intronic
1175951069 20:62583607-62583629 GGCAGGCTGGGAACTCAGCACGG + Intergenic
1176334682 21:5584985-5585007 AGTAGGCTTGGACACCTGCAGGG + Intergenic
1176393075 21:6235963-6235985 AGTAGGCTTGGACACCTGCAGGG - Intergenic
1176468344 21:7080211-7080233 AGTAGGCTTGGACACCTGCAGGG + Intronic
1176491905 21:7461989-7462011 AGTAGGCTTGGACACCTGCAGGG + Intergenic
1176508737 21:7676394-7676416 AGTAGGCTTGGACACCTGCAGGG - Intergenic
1177266443 21:18790984-18791006 AGTAGGCTAGGAAATGTTCTTGG - Intergenic
1177323756 21:19556667-19556689 AGCAGGCAAGAGAGTCTGCAGGG + Intergenic
1178297517 21:31422855-31422877 AGCATGCTAGGGAATCTTTACGG - Intronic
1180326751 22:11436516-11436538 ATCAGTCTAGGAGAACTGCAGGG - Intergenic
1181446814 22:22983038-22983060 AGCAAGCTAGGAAATCTAGAAGG - Intergenic
1184306308 22:43604891-43604913 AGCAGGCTCGGAAATATCCGTGG - Intronic
1184823105 22:46926751-46926773 AGCAGGCTAGGAACTCGGTCAGG - Intronic
953441257 3:42919566-42919588 TGCAGGTTAGGAAACCTGTATGG + Intronic
955963021 3:64360378-64360400 AGCAGGAGAAGAAAGCTGCAAGG + Intronic
956307262 3:67839256-67839278 AGAATGCCAGGAAATTTGCAAGG - Intergenic
957063936 3:75505645-75505667 AGTGAGCAAGGAAATCTGCATGG + Intergenic
958966356 3:100563120-100563142 AGTTGGCTAGGAGATCAGCATGG - Intronic
960350539 3:116587552-116587574 AGCAGGCTAGTATACCTGGAAGG + Intronic
962957367 3:140278541-140278563 AGCAGACAATGAATTCTGCAAGG + Intronic
964016087 3:151948485-151948507 AGCAAGCTGAGAAATCTGAAAGG - Intergenic
964062264 3:152538345-152538367 AGAAAGCTGGGAACTCTGCATGG - Intergenic
967187059 3:186953275-186953297 AGCAGGAGATGAAGTCTGCAGGG - Intronic
968402607 4:311647-311669 AGTAGGCTAGAGAGTCTGCATGG + Intergenic
969166092 4:5314791-5314813 AACGGGCTGGGAAATTTGCAGGG + Intronic
969849793 4:9947247-9947269 TGCAGGCTAGGACAACTGCAAGG - Intronic
971223358 4:24729344-24729366 AGCAGGCTGGAAATTCTGCCAGG - Intergenic
972363510 4:38351130-38351152 AGGAAGCTAGGAACACTGCATGG + Intergenic
972418335 4:38864170-38864192 AGCAGGCTATAGAATCTACAGGG - Intergenic
972603853 4:40596041-40596063 AGAAGACAAGGAAAGCTGCAAGG + Intronic
973078982 4:45966016-45966038 AAAAAGCTGGGAAATCTGCAAGG - Intergenic
973337116 4:48967858-48967880 AGCAGGCTGGAAACTCTTCAAGG + Intergenic
974936412 4:68414040-68414062 AGCAGGGTGGGAAGGCTGCAAGG - Intergenic
975718209 4:77226219-77226241 AACAGGCAAGGAATTCTACATGG - Intronic
976948593 4:90799984-90800006 AGAAAGCTCGGAACTCTGCACGG - Intronic
979200907 4:117977339-117977361 AGGAAGCTAGGAACTCTGCATGG + Intergenic
981367477 4:143920021-143920043 AGCAGGTTGGGAGACCTGCAGGG - Intergenic
984602690 4:181746399-181746421 ACCAGGATAGAAAATCTCCAAGG + Intergenic
986148625 5:5105570-5105592 AGATGGATAGAAAATCTGCAAGG + Intergenic
986452306 5:7878807-7878829 AGCAGGTTAGAAAAACTTCAGGG - Intronic
989444663 5:41513154-41513176 AGCAGGCCAGGAACTCAGGAAGG + Intergenic
991409647 5:66333405-66333427 AGCAGGCAGGGAAATATGCCAGG + Intergenic
992326250 5:75663152-75663174 AAGAGGCTAGGAAATATTCAGGG + Intronic
993311334 5:86337380-86337402 AGAAAGCTAGGAACCCTGCATGG + Intergenic
993810852 5:92474095-92474117 AGCAGCCTAGGAAGGCAGCATGG + Intergenic
994318858 5:98366118-98366140 AGCAGGTGAGGAGATCTGAAAGG + Intergenic
994680134 5:102876479-102876501 AGGAGGCCAGGAAAGATGCAGGG - Intronic
997427177 5:133811374-133811396 AGCAATCTAGGAAGGCTGCATGG - Intergenic
998821476 5:146061677-146061699 AACAGGCTAGGAGATGTGAAAGG + Intronic
999189425 5:149735546-149735568 AGAAGGCTCAGAAAACTGCATGG - Intronic
1001263333 5:170252332-170252354 TACAGGCTAGGAATTCTGCTAGG - Intronic
1003186067 6:3831748-3831770 AGCAGTCCAGGAAAACTTCATGG + Intergenic
1003925019 6:10869625-10869647 CACAGGTTAGGAAATCTGCATGG + Intronic
1006746120 6:36343351-36343373 AGCAGGACAGGAAATGTCCATGG + Intergenic
1006824815 6:36926935-36926957 AGCAAGCCAGGAACTCCGCAGGG + Intronic
1007292504 6:40798229-40798251 AGCAGGCTTTTAACTCTGCAGGG + Intergenic
1008159255 6:48057371-48057393 AACCAGCAAGGAAATCTGCAGGG - Intronic
1012984259 6:105858053-105858075 GACAGGGTAGAAAATCTGCAGGG + Intergenic
1017123864 6:151048512-151048534 AGAGGGCTAGGGAATCTTCAAGG + Intronic
1018037416 6:159893302-159893324 GGCAGGGCAGGATATCTGCATGG + Intergenic
1020375677 7:7482936-7482958 AGAAGGCTAGGAAATTTAGAGGG + Intronic
1021787718 7:24169047-24169069 AGCAAGCTCTGAAAGCTGCAAGG - Intergenic
1025265620 7:57454514-57454536 AGCAGGCTGGGACATCTGCAGGG - Intronic
1025775644 7:64558495-64558517 AGCAGCCTGAGACATCTGCAGGG - Intronic
1025778829 7:64581570-64581592 AGCAAGCTGGGACATCTGCAGGG - Intergenic
1025798547 7:64762327-64762349 AGTAGGCTGGGACACCTGCAGGG - Intergenic
1025802269 7:64797560-64797582 AGCAGGCTCCGACATCCGCAGGG - Intronic
1025815425 7:64906634-64906656 AGCAGGCTGGGACATCTGCAGGG - Intronic
1025824939 7:65003136-65003158 AGCAGGCTGGGACATCTGCAGGG + Intronic
1025865525 7:65377333-65377355 AGCAGGCTGGGACATCTTCAGGG - Intronic
1027711755 7:81612519-81612541 GGCAGGGTAGGAGTTCTGCACGG - Intergenic
1028415896 7:90580350-90580372 AGCAGGCTATGAAATCAGTAAGG - Intronic
1028482319 7:91321208-91321230 AGTAGCCCATGAAATCTGCATGG - Intergenic
1028499583 7:91504048-91504070 AGCAGGCCAGGAAACTAGCAAGG + Intergenic
1030312954 7:108086296-108086318 AGTAGGCTAGGAAATGAGAAAGG - Intronic
1032332170 7:130990732-130990754 AGCAGGCTAGCCACTCTGCTTGG - Intergenic
1032525031 7:132573596-132573618 TGCAGACAGGGAAATCTGCACGG - Intronic
1032768403 7:135023345-135023367 AGAAAGCTAGGAACCCTGCATGG + Intronic
1034301152 7:150016476-150016498 AACAGGCTAGGAGGTCTGCATGG - Intergenic
1034804903 7:154080830-154080852 AACAGGCTAGGAGGTCTGCATGG + Intronic
1037034101 8:14144413-14144435 AGCAGGTTATGAACTCTGCAAGG - Intronic
1037099005 8:15019557-15019579 AGCAGGCAAGAAAAGCTGAAAGG - Intronic
1037291051 8:17349676-17349698 GGCACATTAGGAAATCTGCATGG - Intronic
1037613077 8:20492917-20492939 AGGAGGTTGGGAAAGCTGCAAGG - Intergenic
1040898122 8:52389615-52389637 AGCAGGGATGGAAATCTGCTGGG + Intronic
1044251099 8:90005000-90005022 AGGAGGCAAGGAAAGCTTCATGG + Intronic
1044673484 8:94707144-94707166 AGCAGCCTCATAAATCTGCACGG - Exonic
1044744139 8:95355865-95355887 ACAAGGCTGGGAAGTCTGCATGG + Intergenic
1045182028 8:99794608-99794630 AGCAGGCTGGGAAAACTACAAGG - Intronic
1045840893 8:106579381-106579403 AGCAGGCCTGGAAAGCAGCAAGG - Intronic
1047755746 8:127917220-127917242 AGCTGGCTAGGAAATGTGGGTGG - Intergenic
1048152742 8:131909936-131909958 AGCAGGCTGGGGACCCTGCATGG - Intronic
1049424260 8:142531090-142531112 AGCAGGCAAAGAAGTCTCCATGG + Intronic
1053685208 9:40514598-40514620 AGAGGGCTAGCAAATCTTCAGGG + Intergenic
1053935169 9:43142888-43142910 AGAGGGCTAGCAAATCTTCAGGG + Intergenic
1054278521 9:63110365-63110387 AGAGGGCTAGCAAATCTTCAGGG - Intergenic
1054298300 9:63350055-63350077 AGAGGGCTAGCAAATCTTCAGGG + Intergenic
1054396317 9:64654572-64654594 AGAGGGCTAGCAAATCTTCAGGG + Intergenic
1054430960 9:65159767-65159789 AGAGGGCTAGCAAATCTTCAGGG + Intergenic
1054499421 9:65861754-65861776 AGAGGGCTAGCAAATCTTCAGGG - Intergenic
1058776435 9:108288689-108288711 AGCATGCAAGTAAAACTGCAAGG + Intergenic
1059887090 9:118758270-118758292 ACCAGCCTAGGAAAGCTGCAGGG - Intergenic
1060058202 9:120434290-120434312 GGCATGCTAGAAAAACTGCAGGG + Intronic
1203426954 Un_GL000195v1:49935-49957 AGTAGGCTTGGACACCTGCAGGG - Intergenic
1185574681 X:1162082-1162104 AGCATGCTAAGTCATCTGCATGG + Intergenic
1186689517 X:11960221-11960243 AGCTGGAAAGGAAATCTGGAGGG - Intergenic
1188135044 X:26484405-26484427 AGCAGGCAAGCGCATCTGCAGGG - Intergenic
1189121907 X:38404270-38404292 AGCAAGGTAGGAAGTATGCAGGG - Intronic
1189676893 X:43469930-43469952 AACAAGCTGGGAAATTTGCAGGG + Intergenic
1189790416 X:44598474-44598496 AGGAGGCAAGGAAACCCGCATGG - Intergenic
1189891896 X:45611132-45611154 AGGAGGCTAGGAGCACTGCATGG - Intergenic
1189897650 X:45672810-45672832 AGGAAGCTAGGAACCCTGCATGG + Intergenic
1193689479 X:84622848-84622870 AGGAGGCTGGGAACCCTGCATGG - Intergenic
1193790365 X:85808910-85808932 AGGAAGCTGGGAACTCTGCATGG - Intergenic
1194502178 X:94695150-94695172 AGGAGGCTTGGAACCCTGCATGG - Intergenic
1194640424 X:96397675-96397697 ATCATGCTAGAAAATCAGCAAGG - Intergenic
1195552471 X:106184883-106184905 AGCAAGCAAAGAAATCTCCAAGG - Intronic
1195826544 X:109007396-109007418 ATCAGGCAAGAAAATCTGTAAGG + Intergenic
1198633707 X:138672464-138672486 AGAAGGCAAGGAAAACTCCAAGG + Intronic
1198891732 X:141403851-141403873 AGGAAGCTGGGAACTCTGCACGG - Intergenic
1200315139 X:155124576-155124598 AGCAGGCTGGGATTACTGCATGG + Intronic
1201407588 Y:13664218-13664240 AGCAAGCAAAGAAATCTCCAAGG - Intergenic
1202015295 Y:20399800-20399822 TGCAGGCCAGGAACTCTGTAAGG + Intergenic