ID: 1164226514

View in Genome Browser
Species Human (GRCh38)
Location 19:23250560-23250582
Sequence GCCTGAAAACGCTGCAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 6, 2: 13, 3: 24, 4: 367}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164226514_1164226518 9 Left 1164226514 19:23250560-23250582 CCTAAGCTGCAGCGTTTTCAGGC 0: 1
1: 6
2: 13
3: 24
4: 367
Right 1164226518 19:23250592-23250614 TCCCTGAGCTTAGCCCACCCCGG No data
1164226514_1164226521 12 Left 1164226514 19:23250560-23250582 CCTAAGCTGCAGCGTTTTCAGGC 0: 1
1: 6
2: 13
3: 24
4: 367
Right 1164226521 19:23250595-23250617 CTGAGCTTAGCCCACCCCGGAGG No data
1164226514_1164226522 13 Left 1164226514 19:23250560-23250582 CCTAAGCTGCAGCGTTTTCAGGC 0: 1
1: 6
2: 13
3: 24
4: 367
Right 1164226522 19:23250596-23250618 TGAGCTTAGCCCACCCCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164226514 Original CRISPR GCCTGAAAACGCTGCAGCTT AGG (reversed) Intergenic