ID: 1164226518

View in Genome Browser
Species Human (GRCh38)
Location 19:23250592-23250614
Sequence TCCCTGAGCTTAGCCCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164226514_1164226518 9 Left 1164226514 19:23250560-23250582 CCTAAGCTGCAGCGTTTTCAGGC 0: 1
1: 6
2: 13
3: 24
4: 367
Right 1164226518 19:23250592-23250614 TCCCTGAGCTTAGCCCACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164226518 Original CRISPR TCCCTGAGCTTAGCCCACCC CGG Intergenic