ID: 1164232619

View in Genome Browser
Species Human (GRCh38)
Location 19:23303535-23303557
Sequence TAGAGGACGTTCAGGACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164232619_1164232625 26 Left 1164232619 19:23303535-23303557 CCAAATGTCCTGAACGTCCTCTA No data
Right 1164232625 19:23303584-23303606 AGAACTATAGTTTTTGTGTCTGG No data
1164232619_1164232623 -1 Left 1164232619 19:23303535-23303557 CCAAATGTCCTGAACGTCCTCTA No data
Right 1164232623 19:23303557-23303579 AGTCATTGTCAGCTTCAATAGGG No data
1164232619_1164232624 0 Left 1164232619 19:23303535-23303557 CCAAATGTCCTGAACGTCCTCTA No data
Right 1164232624 19:23303558-23303580 GTCATTGTCAGCTTCAATAGGGG No data
1164232619_1164232622 -2 Left 1164232619 19:23303535-23303557 CCAAATGTCCTGAACGTCCTCTA No data
Right 1164232622 19:23303556-23303578 TAGTCATTGTCAGCTTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164232619 Original CRISPR TAGAGGACGTTCAGGACATT TGG (reversed) Intergenic
No off target data available for this crispr