ID: 1164237523

View in Genome Browser
Species Human (GRCh38)
Location 19:23350124-23350146
Sequence ACTTATTAGCAGAAAAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 2, 1: 4, 2: 9, 3: 30, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164237519_1164237523 21 Left 1164237519 19:23350080-23350102 CCAAATGCGTGCAGCAATTTATC 0: 2
1: 5
2: 4
3: 13
4: 73
Right 1164237523 19:23350124-23350146 ACTTATTAGCAGAAAAAGGTGGG 0: 2
1: 4
2: 9
3: 30
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164237523 Original CRISPR ACTTATTAGCAGAAAAAGGT GGG Intronic
901794100 1:11670622-11670644 ACTTATTAAAAAAAAAAGGGGGG + Intronic
903411673 1:23149342-23149364 ACTGACTAGCAGAGAAAGGGTGG - Intronic
905834371 1:41104778-41104800 GCTTATTAGGAAAAAAAGCTGGG + Intronic
907585857 1:55617247-55617269 ACTTATTTTCAGAAAAAGGGGGG + Intergenic
907835266 1:58102687-58102709 ATTCATTAAAAGAAAAAGGTGGG - Intronic
908003249 1:59702406-59702428 ACTTATTGGGAGAAAAGGTTAGG + Intronic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
916334751 1:163658061-163658083 AATTGTTAGCAAAAAAAAGTTGG - Intergenic
917581121 1:176378938-176378960 ACTCATCACCAGAAGAAGGTTGG - Intergenic
917828686 1:178852943-178852965 ACTTATTAACAGAAAGGGTTTGG - Exonic
917872867 1:179257355-179257377 ACCTCTTGGCAGAACAAGGTGGG - Intergenic
919134194 1:193488215-193488237 ATTTATTAACTAAAAAAGGTGGG - Intergenic
921610106 1:217202771-217202793 ACTAATTAACAGAAAAAGGGAGG - Intergenic
921615421 1:217260767-217260789 ACTCATTAGCAGGAACAGGCTGG + Intergenic
923187528 1:231588489-231588511 ACTGATTAACAGCAAATGGTGGG + Intronic
924519617 1:244794716-244794738 TCTTACTAGCATAAAAATGTGGG + Intergenic
1064529058 10:16288601-16288623 AATTATTAGCAGTAAGAAGTTGG + Intergenic
1067817229 10:49489658-49489680 ACTACGTAGCAAAAAAAGGTAGG + Intronic
1068128330 10:52867997-52868019 ACTTATTAACAGGTAGAGGTTGG + Intergenic
1068148032 10:53096699-53096721 ACTCATTAACAGAAAGAGGTTGG + Intergenic
1068247443 10:54390990-54391012 ACTTATAATCATAAAAAGATGGG + Intronic
1073882225 10:107996314-107996336 ATTTATAAGCAGAAAAAATTTGG + Intergenic
1074859731 10:117501314-117501336 ATTAATGAGCAGAAAAAGATTGG + Intergenic
1076673375 10:132135314-132135336 CTTTATTAGCAAAAACAGGTAGG + Intronic
1080935876 11:36862814-36862836 ACTTGTTGGCAGAAAAAAATAGG - Intergenic
1082032716 11:47617345-47617367 ATTTTTTGGGAGAAAAAGGTAGG + Exonic
1082203716 11:49405433-49405455 ACTTATTAGCTGTAAGAGCTTGG + Intergenic
1082635346 11:55586833-55586855 ACTTATTAGCAGAAGAAGGTGGG + Intergenic
1085064591 11:73482444-73482466 ACTTATGACCAGCAAAAGGTGGG - Intronic
1085303141 11:75470146-75470168 ACTTATTGAGAGAACAAGGTTGG + Intronic
1086848776 11:91783933-91783955 ACTGAGTAACAGACAAAGGTTGG - Intergenic
1086884709 11:92191927-92191949 AGTTATTAGCAAAAAAAGATGGG - Intergenic
1087048262 11:93862565-93862587 ACTTATTAGCAGAAGAGGGTGGG - Intergenic
1087426759 11:97998019-97998041 ACTTATTAGGTGAAAGAGGTAGG + Intergenic
1087965064 11:104402959-104402981 GCTGATTAGCAGAAGGAGGTGGG - Intergenic
1090490142 11:127153494-127153516 CCTTTTCAGGAGAAAAAGGTAGG - Intergenic
1090500924 11:127260136-127260158 ACTTAATATCAGATAAAGTTGGG - Intergenic
1094748465 12:33376153-33376175 ACTTATTGGCTGAAAAACGGAGG - Exonic
1095775107 12:46002085-46002107 ACTTACTAGAAGAAGGAGGTTGG + Intergenic
1096960528 12:55572322-55572344 ACTTCTTACCAGGAAAAGTTTGG + Intergenic
1097422130 12:59392951-59392973 ACTTGTTAACAGAACAAGGCAGG + Intergenic
1098505584 12:71246731-71246753 AGATATTACCAGAAAAAGCTGGG + Intronic
1098989049 12:77044592-77044614 ACTTACTAGCACATAAAGGGTGG - Intronic
1099283974 12:80692071-80692093 ACTTATTAGACTGAAAAGGTAGG + Intergenic
1099451978 12:82819016-82819038 ACTAATTATTAGGAAAAGGTAGG - Intronic
1099862226 12:88234727-88234749 ACTTATTAGCAGAAGAGGGTGGG + Intergenic
1100143750 12:91651629-91651651 ACTTATTCCCAGATAAATGTGGG - Intergenic
1100492199 12:95091779-95091801 ACTTATTAGACGAACAAGCTTGG + Exonic
1100632413 12:96401347-96401369 CCTTATTAGTGGAAAAAAGTGGG - Intergenic
1101470109 12:104987873-104987895 ATTCATTAGCAGACAAACGTGGG - Intronic
1102778902 12:115546556-115546578 ACTTAAAAGCAGAAAGATGTAGG + Intergenic
1103118328 12:118357391-118357413 ACGTGTTAGCAGAAAAAAGATGG - Intronic
1109093003 13:58072382-58072404 ACTTGGTAGCAGACAAAGGCTGG - Intergenic
1110070907 13:71176235-71176257 ACTAATTGGCAGTAAAACGTAGG - Intergenic
1110159040 13:72353130-72353152 AATTCTAGGCAGAAAAAGGTAGG - Intergenic
1110435845 13:75477649-75477671 ACTTTTTAACAGAAAAATTTGGG + Intronic
1110467063 13:75814312-75814334 ACATATTAGCAGCACAAGGCAGG - Intronic
1112997251 13:105589164-105589186 AATTACTGGCAGAAAAATGTTGG - Intergenic
1114146062 14:19979652-19979674 GCTGAATAGCAGAAAAAGGATGG + Intergenic
1115300317 14:31878187-31878209 ATTTATTATTAGAAAAGGGTTGG + Intergenic
1115627338 14:35207009-35207031 TCTTAAAAGCAGAAAAATGTAGG - Intronic
1118020223 14:61704544-61704566 ACTTGTTAGCAGAGGAAAGTTGG + Intronic
1118037049 14:61879069-61879091 AATTAATAGCAGGAAAGGGTTGG - Intergenic
1122911890 14:104833947-104833969 ACTAATTAAAAGAAAAAGATTGG - Intergenic
1124885226 15:33679042-33679064 ACTTATTAGCAGAGAAGGTCAGG - Intronic
1125351170 15:38769104-38769126 CCATATTAGCAGAAAGAGATGGG - Intergenic
1126077737 15:44929533-44929555 ACTTAGTATCAAAAAAATGTAGG + Intergenic
1129172286 15:73815560-73815582 ACTTATTAGCAGCAAAAGCCAGG + Intergenic
1129967989 15:79753844-79753866 ACTTATTAGCAGAAGACCTTGGG - Intergenic
1130821166 15:87497164-87497186 AGATATTTGCAGAAAAATGTGGG + Intergenic
1131614892 15:94005818-94005840 ATTTAACAGCAGAAAATGGTAGG - Intergenic
1133547971 16:6826344-6826366 TCTTATTTACAGAAAAAGGGAGG + Intronic
1135126340 16:19812823-19812845 AATTCATTGCAGAAAAAGGTAGG + Intronic
1135844198 16:25903577-25903599 ACTTATTAGAAGCAAAAGGGAGG + Intronic
1136123881 16:28162199-28162221 ACTCATTTGCCTAAAAAGGTTGG + Intronic
1137070791 16:35903118-35903140 ACTTATTAGCAGAAGAGAGTGGG - Intergenic
1137372126 16:47917230-47917252 ATTTATTAGCAGAGAAAGAATGG + Intergenic
1138267167 16:55667900-55667922 ACTTATCAGCAGGATAAGGTCGG + Intronic
1138463435 16:57168216-57168238 AATTATCAGCCCAAAAAGGTGGG + Intronic
1141029332 16:80574065-80574087 ACTGAGTAGCAGACAAAGGCAGG - Intergenic
1141690550 16:85594075-85594097 ACTTCTTTGCAGAAAAGGGAGGG + Intergenic
1143089545 17:4440961-4440983 ACTGATTATAAGAAAAATGTTGG - Intronic
1145753560 17:27373326-27373348 ACTTGGTAGCAGACAGAGGTTGG + Intergenic
1146980383 17:37155513-37155535 ACTTATTAGCTGAAGAACCTTGG - Intronic
1149301702 17:55310433-55310455 AATTATTAGTAAAACAAGGTTGG + Intronic
1150435974 17:65154532-65154554 ACTATTTAGCAGAAAAAAGTTGG + Intronic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1153403019 18:4702004-4702026 AATCATTAGGTGAAAAAGGTAGG + Intergenic
1153936346 18:9927881-9927903 ACTTAGTGGCAGGAAATGGTAGG + Intronic
1155657565 18:28209695-28209717 ACTTATTAGCAGAAAAAGGTGGG - Intergenic
1156391370 18:36653396-36653418 ACCTATTAGAAGAGAAAGATCGG - Exonic
1157647596 18:49292410-49292432 ACTGTTTACCAGAAAAAGGAAGG - Intronic
1159173724 18:64807279-64807301 ACTAATTAAAATAAAAAGGTGGG + Intergenic
1159495717 18:69200987-69201009 GCATATCAACAGAAAAAGGTAGG - Intergenic
1160033697 18:75282814-75282836 ACTTATTAGCACACACAGGTTGG + Intronic
1161542231 19:4859039-4859061 ACTTATTAGTCAGAAAAGGTTGG - Intronic
1162617771 19:11815567-11815589 AATTTTTAACAGAAAAAAGTGGG - Intronic
1163077438 19:14907165-14907187 ACTTATTATGAGAAACAGGATGG + Intergenic
1164237523 19:23350124-23350146 ACTTATTAGCAGAAAAAGGTGGG + Intronic
1166048709 19:40245229-40245251 ACTTCTTAAGAGAAAAAGGAAGG + Intronic
1167631535 19:50629169-50629191 ACATTTTAACAGAAAAATGTGGG + Intronic
1168302055 19:55410738-55410760 ACTTATGAACAGAAACAGGGAGG + Intergenic
925656867 2:6158480-6158502 CCTTAGCAGCAGAAAAAGGCAGG - Intergenic
926278618 2:11425739-11425761 ACTTATTAGCAGAAGAGGGTGGG + Intergenic
931101723 2:59009745-59009767 ACTTATTAGCAGTAAAATGTTGG + Intergenic
931734394 2:65180838-65180860 ACTAGGTAGCAGGAAAAGGTGGG + Intergenic
935534276 2:104274642-104274664 AGTTATCAAAAGAAAAAGGTGGG + Intergenic
935719724 2:105969330-105969352 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
936855486 2:116952963-116952985 ACTTTTGAGCTGAAAAAGGCAGG - Intergenic
937674372 2:124573212-124573234 ACTTCTTATCAGAGAAAGGAAGG + Intronic
938876159 2:135532973-135532995 ACTTGTTAGCAGAATAAACTTGG + Intronic
939253698 2:139716210-139716232 ACTTACTAGCTGAATAAGCTTGG - Intergenic
941503376 2:166309366-166309388 AATTATTAGCAGGAAAAAATAGG + Intronic
943904104 2:193475741-193475763 ATCTTTTAGCAGAAAAAGGAGGG + Intergenic
944454472 2:199878856-199878878 AATTCTTAGCAGAAGAGGGTGGG - Intergenic
944661825 2:201927867-201927889 ACTTAGGAGAAGAAAAAGGGGGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
1169915103 20:10675314-10675336 AGTTATGAGCATAAAAGGGTGGG + Intergenic
1170004819 20:11655227-11655249 ATTTATCACCTGAAAAAGGTGGG - Intergenic
1170799889 20:19582464-19582486 AGTTAAAAGCAGAAAAATGTGGG + Intronic
1173022170 20:39275879-39275901 ACTTTTTAGCAGAAAGAGTGAGG - Intergenic
1174397413 20:50256361-50256383 ACTTATTAGAAGAGAAACTTTGG - Intergenic
1176335297 21:5592019-5592041 ACTTTTTAGCAGAATAAACTAGG + Intergenic
1176392460 21:6228929-6228951 ACTTTTTAGCAGAATAAACTAGG - Intergenic
1176468959 21:7087245-7087267 ACTTTTTAGCAGAATAAACTAGG + Intergenic
1176492520 21:7469023-7469045 ACTTTTTAGCAGAATAAACTAGG + Intergenic
1176508122 21:7669360-7669382 ACTTTTTAGCAGAATAAACTAGG - Intergenic
1177767747 21:25477339-25477361 ACATATTGACAGAATAAGGTGGG + Intergenic
1177898629 21:26885604-26885626 AGTTAGTATCAGAGAAAGGTTGG + Intergenic
1178399467 21:32272911-32272933 ACTAATTAGCAGTAAGAGCTAGG - Intronic
1179120359 21:38539695-38539717 ACCCATTAGCAAAACAAGGTGGG - Intronic
1179170039 21:38965912-38965934 CCTCATTTGCAGAAACAGGTGGG - Intergenic
1179413645 21:41180838-41180860 ATTTACTAGCTGAACAAGGTGGG - Intronic
1181993221 22:26854115-26854137 ACTTATGAGCAGGAAAGGGCAGG + Intergenic
1183140391 22:35932482-35932504 ATTGATTAGCAGAAACAAGTGGG - Intronic
949374658 3:3375000-3375022 ACTTCTCAGCAGAAAAACATAGG + Intergenic
950997410 3:17518156-17518178 AATTCTAAGCAGAAAAGGGTGGG + Intronic
952781022 3:37098851-37098873 ACACATTAGCAGAAAAGAGTTGG - Intronic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
953391254 3:42535188-42535210 ACTTATTACAGTAAAAAGGTTGG - Intronic
955732085 3:61997719-61997741 AATGACTGGCAGAAAAAGGTGGG - Intronic
957313212 3:78545493-78545515 GCTCATTAGCAGCCAAAGGTTGG - Intergenic
957416623 3:79914056-79914078 ACCTATTTGGAGATAAAGGTAGG + Intergenic
959818633 3:110705022-110705044 ACTGAGTAGCAGGCAAAGGTTGG - Intergenic
960129441 3:114039203-114039225 ACTTATTAGAAAAAAAAATTGGG + Intronic
960306407 3:116066904-116066926 ACTTATTTGCAAAAAAAAATGGG - Intronic
960382634 3:116983071-116983093 ACTTTTGAGGAGAAAAAGGGAGG + Intronic
961249523 3:125488654-125488676 AATTCTTATCAGACAAAGGTGGG - Intronic
961379998 3:126490878-126490900 ACTTCTTAGCTGAAACAGCTGGG - Intronic
961398549 3:126616420-126616442 ACAGAATGGCAGAAAAAGGTGGG + Intronic
961948545 3:130720485-130720507 ACTTATCAGAAGACAAATGTGGG + Intronic
962295185 3:134177111-134177133 ACACATCAGCAGAAAAAGCTAGG - Intronic
963258074 3:143166147-143166169 AATTTTTAGCAGAAAATGCTTGG - Intergenic
963515151 3:146300220-146300242 AGCTTTTAGTAGAAAAAGGTTGG - Intergenic
963617779 3:147564700-147564722 TCTTATAAGCAGAATAAAGTTGG - Intergenic
964156914 3:153596826-153596848 ACTCATTAGCAGAGAAATTTTGG + Intergenic
964348416 3:155778538-155778560 ATTTTTTAGGAGAAAAAGTTGGG + Intronic
964361854 3:155906975-155906997 AGTTAGTAAAAGAAAAAGGTGGG + Intronic
964876662 3:161375153-161375175 ACTGATTAGTAGAAAGAGCTAGG - Intergenic
965872821 3:173281025-173281047 GCTTATTAGCAGAAGAGGGTGGG + Intergenic
966975764 3:185082094-185082116 AATTAAAAGCAGAAAAATGTTGG + Exonic
967548821 3:190765275-190765297 ACTAAGTAGCAGAAAGGGGTAGG + Intergenic
970339827 4:15094168-15094190 ACATATTAACAGAAAAAAGGGGG - Intergenic
970398414 4:15694894-15694916 TGTTATTAGCCAAAAAAGGTAGG - Intronic
971088771 4:23314585-23314607 ACATGTTATCACAAAAAGGTTGG - Intergenic
972997093 4:44894146-44894168 AATTATTAGATGAAAAAGGAAGG - Intergenic
973160569 4:47011171-47011193 AAACATTAGCAGAAAAAGGTGGG + Intronic
973641647 4:52908837-52908859 ACTAATAAGCATAAAAAGGTTGG - Intronic
974148655 4:57977454-57977476 AATTATTTACAGAATAAGGTAGG + Intergenic
974413500 4:61573052-61573074 ACTTATTAGCACAGAAAGCTAGG + Intronic
975017259 4:69437749-69437771 AGCTATTAGGAGAAAAAGGTAGG - Intergenic
975317364 4:72970002-72970024 ACTTATTGGCAGAAGCAGGAGGG + Intergenic
976337478 4:83907151-83907173 ACATATTAGAAGAAGAATGTGGG + Intergenic
977701477 4:100027931-100027953 AATGAGTAGCAGAAGAAGGTAGG - Intergenic
978626860 4:110695235-110695257 ACTTATTAAAAGTAAAAGGATGG - Intergenic
978875446 4:113635482-113635504 ACTTATTTTCAGAAAAAGGAAGG + Intronic
979227817 4:118309732-118309754 ACTTATTAGCAGAACTAGGGAGG + Intronic
980531570 4:134062891-134062913 ACCTATTTGGAGAAAAAGGGAGG + Intergenic
980650681 4:135711313-135711335 ACTCAGTAACAGAAAGAGGTTGG + Intergenic
981206232 4:142043817-142043839 ACTTATGAGCAGCAAAGTGTTGG + Intronic
983990038 4:174107490-174107512 TCTTATAAGCAGAAAAATATTGG - Intergenic
984613234 4:181865460-181865482 ACTTTTTAGCAGAAAACTGAAGG - Intergenic
984635174 4:182102434-182102456 AATGATTAGCAGACAAAGCTTGG + Intergenic
986559135 5:9043190-9043212 CCTAATTACCAGAATAAGGTTGG + Intronic
986894262 5:12346721-12346743 ACTGGATAACAGAAAAAGGTTGG + Intergenic
987456751 5:18156833-18156855 ACTAATTAACAGAAAGAGGTAGG - Intergenic
989334773 5:40302730-40302752 ATTTATAAGCTGAAAAAAGTGGG + Intergenic
989427318 5:41311729-41311751 ACTTATTAGCAATTAAAGGGAGG - Exonic
989966770 5:50474350-50474372 ACTGGGTAACAGAAAAAGGTTGG + Intergenic
990021035 5:51127885-51127907 ACTGAGTAACAGGAAAAGGTTGG + Intergenic
990396505 5:55385408-55385430 ACTTAGCAGCAGCAACAGGTAGG + Intronic
990808404 5:59693674-59693696 AGTTATTTGCAAAAAAAGTTAGG + Intronic
991004053 5:61810564-61810586 AATTATAAGCAGAAACAGCTGGG + Intergenic
991133246 5:63150917-63150939 ACATATTTGAAGAAAAATGTTGG + Intergenic
991955394 5:71989088-71989110 CCTGATCAGCAGTAAAAGGTTGG + Intergenic
993461248 5:88185077-88185099 ACTTATTAGAAGAAAAAAGCAGG - Intergenic
993554541 5:89319053-89319075 ACTCATTAAGAGAAAAATGTGGG + Intergenic
994302372 5:98160739-98160761 ACCTCTTGGCAGAACAAGGTAGG + Intergenic
994733266 5:103520056-103520078 ACTTATGTGGAGAAAAAGGTGGG + Intergenic
995344271 5:111093437-111093459 GCTTATTAGCAAAAAGAGCTGGG + Intronic
999650983 5:153767326-153767348 TCTTATTAGCTGAAAGACGTTGG - Intronic
999825136 5:155266535-155266557 AATGACTAGGAGAAAAAGGTAGG - Intergenic
1000817959 5:165947188-165947210 AGTGATTAGTAGAAAAAGATTGG - Intergenic
1003215089 6:4101984-4102006 ACTTTTTAGCATAAAAAAGAAGG + Intronic
1004766664 6:18736264-18736286 ACTTGTTAGTAGAAAAATATAGG + Intergenic
1005058483 6:21753754-21753776 ACTTATTGGCAGATTAACGTAGG - Intergenic
1005149593 6:22733829-22733851 AGTCTTTAGCAGGAAAAGGTAGG - Intergenic
1006035788 6:31210947-31210969 GCTAATTAGCAGCCAAAGGTTGG - Intergenic
1007896482 6:45366554-45366576 AGTTTTTAGCAGATAAAGGAGGG - Intronic
1008215535 6:48783248-48783270 AATTCTAGGCAGAAAAAGGTGGG - Intergenic
1008905132 6:56668989-56669011 ACTTATTAGCAGTATAAACTTGG + Intronic
1013049171 6:106515339-106515361 ACTTAATAGCACAGAAAGTTTGG + Intronic
1013440501 6:110160800-110160822 AATTATTCAAAGAAAAAGGTAGG - Intronic
1014197638 6:118577678-118577700 AAATATTAGCTGAAAAAGGTGGG + Intronic
1014393774 6:120898177-120898199 ACTTATAACAAGAAATAGGTTGG + Intergenic
1015426525 6:133076055-133076077 ACTTACTAGCAGAATAATGTGGG + Intergenic
1016292816 6:142542342-142542364 GCTTATTAGCAGAAGAAGGTGGG + Intergenic
1016566157 6:145457158-145457180 ACTTATTAGCAGAAAAACTTTGG - Intergenic
1017016032 6:150100192-150100214 ACTTATCAGCAGAAGAAGGTGGG + Intergenic
1017578449 6:155833364-155833386 ACTTTTTAGAGGAAAAAGATAGG - Intergenic
1020121669 7:5507537-5507559 AATAATTAGCAGAACAAGGCCGG + Intronic
1021416804 7:20395817-20395839 ACTAATAAGCAGAAGAAAGTGGG + Intronic
1021738066 7:23658346-23658368 TGTTATTAGCCAAAAAAGGTGGG + Intergenic
1021897270 7:25249184-25249206 ACTTAGTAGCTTAAAAAAGTAGG + Intergenic
1022934770 7:35162722-35162744 ACTTGTTCGGAGAAAAATGTGGG - Intergenic
1026076340 7:67173289-67173311 ACTTATTTGTGGAAGAAGGTGGG + Intronic
1026209736 7:68293398-68293420 ATTTATTCGCAGAAAAATGTGGG - Intergenic
1026700517 7:72638993-72639015 ACTTATTTGTGGAAGAAGGTGGG - Intronic
1027969683 7:85062798-85062820 ACTTAGTTACAGGAAAAGGTTGG + Intronic
1028333927 7:89628344-89628366 AGTGGTTAGCAGCAAAAGGTAGG - Intergenic
1028809057 7:95062765-95062787 ACATAGAAGCAGAAAAAAGTGGG - Intronic
1029940493 7:104475493-104475515 ACTTATAAGATGAAAAAGTTGGG + Intronic
1030804856 7:113903577-113903599 ACCTCTTAGCAGAAAAAGTTGGG + Intronic
1032712067 7:134469236-134469258 ACTTGTTAGCAGAAGAAGGTGGG + Intergenic
1034125548 7:148668406-148668428 AATTTTTAGTAGAAAAATGTGGG - Intergenic
1035685139 8:1518561-1518583 ATTTATTAGCTGATCAAGGTTGG - Intronic
1038407657 8:27334065-27334087 AGATATGAGCAGAAAAAAGTGGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041573149 8:59360720-59360742 ACTTATAAGCAGCAAATGGTAGG - Intergenic
1041916570 8:63145059-63145081 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
1042398335 8:68316964-68316986 ACCTATTATCAGACAAGGGTAGG + Intronic
1043051808 8:75394299-75394321 TCTGATGAGCAGGAAAAGGTAGG - Intergenic
1043856892 8:85274592-85274614 ACTTATTAGCAGAAGAAGGTGGG - Intronic
1043982940 8:86661596-86661618 ACTTATTAGTGGGAAAAAGTTGG - Intronic
1045572444 8:103382038-103382060 ACTTATCAGCAGATAAGTGTCGG + Intronic
1050854698 9:10338269-10338291 ACTCATTAGCAGAAAAGGTGAGG - Intronic
1051385987 9:16509304-16509326 ACTTATTGGCATATAAATGTTGG + Intronic
1051493578 9:17694367-17694389 ACTTATTAGCATTAAAAAATAGG - Intronic
1052019931 9:23514157-23514179 ACTTATTAGCAACAAAACCTTGG + Intergenic
1052158216 9:25222085-25222107 ACTTGTTGGGAGAGAAAGGTAGG + Intergenic
1052871193 9:33508725-33508747 ACTTATCAACAGAAACAAGTTGG + Intergenic
1056032577 9:82568260-82568282 ATTTATCTGCATAAAAAGGTGGG + Intergenic
1057782841 9:98063841-98063863 ACTTATTAGCACAAAAAAACAGG - Intronic
1203426342 Un_GL000195v1:42901-42923 ACTTTTTAGCAGAATAAACTAGG - Intergenic
1185480917 X:445648-445670 AGTTATGAGCAGAAAAAGTTTGG + Intergenic
1186234679 X:7494814-7494836 ATTTATTAACAGAAAAATATGGG - Intergenic
1188077692 X:25798612-25798634 AATTATTAGTAGAAAAATATTGG + Intergenic
1188225907 X:27597224-27597246 ACTTTTTAGCAGATATAGGAAGG + Intronic
1188283711 X:28302282-28302304 ACTTATAAGTAGTAGAAGGTAGG - Intergenic
1188550631 X:31360951-31360973 ACTTATTTGTATTAAAAGGTGGG + Intronic
1188957944 X:36455858-36455880 ACTTATAAGCAGGAAGAGATGGG + Intergenic
1189224338 X:39399982-39400004 ACATAGTAGCAGAAACAGGTTGG - Intergenic
1190535438 X:51421827-51421849 GCTCATTAGCAGCTAAAGGTTGG - Intergenic
1191714113 X:64182462-64182484 ACTTATTAGCAGATTTAAGTGGG + Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191866258 X:65706234-65706256 TCTTAGTAGCAGGAAATGGTGGG + Intronic
1192038754 X:67594628-67594650 GCTTATTAGCAGTAGTAGGTAGG - Intronic
1192282040 X:69697899-69697921 AGTTATTAGCAGAAGAGAGTGGG - Intronic
1193591483 X:83393288-83393310 GCTTATTAGCAGCCAAATGTTGG - Intergenic
1194654522 X:96556014-96556036 ACTAATGAAGAGAAAAAGGTAGG + Intergenic
1196197729 X:112853777-112853799 GCTTATAATCAGAAAAAGTTTGG + Intergenic
1196963803 X:121033192-121033214 ACTTATGAGCAGCGAAATGTGGG + Intergenic
1197637961 X:128937436-128937458 ACTTATTAGCTGGTAATGGTGGG + Intergenic
1197947149 X:131851756-131851778 ACTTATTAGCAGAAGAGGGTGGG - Intergenic
1198605294 X:138330919-138330941 ACTTATTGGCAGGAAGAGGTTGG - Intergenic
1198913978 X:141646262-141646284 ACTTATTGGCAGAAATAAGAGGG - Intronic
1199193196 X:144996592-144996614 ACTGATTAACAGACAGAGGTTGG + Intergenic
1199269402 X:145865105-145865127 AATTAATAGCAGGAAGAGGTAGG - Intergenic
1199824423 X:151484312-151484334 ACTTCTTAGAAGAGAAGGGTTGG - Intergenic
1200950689 Y:8896605-8896627 CCTTGTTAGCAGAAATAGGAGGG + Intergenic
1201385854 Y:13438899-13438921 CCTTATTACCAGCAAAAGGGAGG + Intronic