ID: 1164239620

View in Genome Browser
Species Human (GRCh38)
Location 19:23373072-23373094
Sequence ATCTGGGTTTGTAGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 5, 2: 11, 3: 33, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164239620_1164239623 -3 Left 1164239620 19:23373072-23373094 CCTTCTTCACTACAAACCCAGAT 0: 1
1: 5
2: 11
3: 33
4: 228
Right 1164239623 19:23373092-23373114 GATGACATTCTATCACTCTGAGG 0: 1
1: 2
2: 1
3: 16
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164239620 Original CRISPR ATCTGGGTTTGTAGTGAAGA AGG (reversed) Intronic
900736378 1:4301852-4301874 ATCTGTATCTGTAGTAAAGATGG + Intergenic
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
906189529 1:43887425-43887447 AAGTGGGTTTGGAGTGTAGAAGG + Intronic
908267133 1:62390447-62390469 GTCTGAGTTTTCAGTGAAGAAGG - Intergenic
909183966 1:72461557-72461579 ATTTGTGTTTTTAGTGCAGAGGG - Intergenic
909342092 1:74543647-74543669 TTTTGGGTTTGGAGTAAAGAGGG - Intronic
910369800 1:86503596-86503618 TTCTGGGTTTGTGGTGATGGAGG + Intergenic
912261948 1:108119623-108119645 AGCTGGGCTTGAAGGGAAGAAGG - Intergenic
913281189 1:117186658-117186680 ATCTGGACTTGAAGTGGAGAGGG - Intronic
913984269 1:143551102-143551124 CTCTGGGTTTGGAGTTAAGCTGG - Intergenic
914345174 1:146793008-146793030 ACCTGGGTTTGCATGGAAGATGG - Intergenic
917592994 1:176496600-176496622 ATCTGGGTTCATAGTGTAGGAGG - Intronic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
919734760 1:200939781-200939803 TTTTGTGTTTTTAGTGAAGATGG + Intergenic
919811020 1:201408871-201408893 AACTGGGTTTTTAATGAAGAAGG + Exonic
924179051 1:241423433-241423455 ACCTGGGTATGTAGTCAAAAGGG - Intergenic
924921487 1:248634511-248634533 AGCTGGGATTGTACTGAGGATGG - Intergenic
1064188045 10:13180562-13180584 ATTTGGGGTTATATTGAAGAAGG + Exonic
1065162481 10:22937466-22937488 ATGTGGGTTGGTGGAGAAGATGG + Intronic
1065976817 10:30849026-30849048 ATCTGGGACTGTAGTGTAGTTGG + Exonic
1068964250 10:62895814-62895836 TTTTGTGTTTGTAGTAAAGATGG - Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1071203747 10:83251090-83251112 ATTTGGGTTTGTAGGGGACAAGG + Intergenic
1074453648 10:113579305-113579327 ATGTGGGTTGGTGGTGATGATGG + Intronic
1075678780 10:124317500-124317522 ATCTGTGTTTGTAGCAGAGAGGG + Intergenic
1076473649 10:130737456-130737478 ATGAGGGTTTCTAGTGGAGAGGG + Intergenic
1079231842 11:18655850-18655872 TTTTGGATTTTTAGTGAAGATGG - Intergenic
1079531354 11:21458061-21458083 ATCTGGCTGTGAAGAGAAGAAGG + Intronic
1079784063 11:24648772-24648794 ATCTGAGTTTGTAGAGTACAAGG - Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1081144974 11:39551974-39551996 ATGTGTGTGTGTAGTGAAAAAGG - Intergenic
1083295328 11:61712307-61712329 CCCTGGGGTTGTAGTGAGGATGG + Intronic
1083465163 11:62840753-62840775 TTTTGGTTTTTTAGTGAAGACGG + Intronic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1085555762 11:77420140-77420162 ATTTGGGTTGGTATTGAAGAAGG + Intronic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1085922108 11:80969757-80969779 ATCAGGCTTTGTAATGAAGCAGG + Intergenic
1088151030 11:106745611-106745633 AGATGGGTTGGTAGTTAAGAAGG - Intronic
1088621174 11:111685491-111685513 ATTTCTGTTTGAAGTGAAGAGGG + Intronic
1088763890 11:112958405-112958427 ACCTGGGTATGTTGTGAAGATGG - Intergenic
1089855724 11:121543003-121543025 ATTTGTATTTGTAGTAAAGACGG - Intronic
1091061322 11:132465343-132465365 ATGTGGCTTTGTTGTGAATAAGG - Intronic
1092418253 12:8308596-8308618 ACCTGGGATGGTAGTGAAGTGGG + Intergenic
1092558990 12:9589656-9589678 TTCTGTGTTTCTAGTGGAGATGG - Intergenic
1092901601 12:13064873-13064895 ATCTGGGTTTAGAGTGAAGTGGG + Intronic
1093553146 12:20438963-20438985 TTTTGTGTTTTTAGTGAAGACGG + Intronic
1093686265 12:22057995-22058017 ATTTGTGTTTTTAGTGGAGATGG + Intronic
1095809603 12:46357794-46357816 ATCTGGTTTTTTACTTAAGAAGG - Intergenic
1096386078 12:51196217-51196239 ATCTGGGTTTGGGGTGGAGCTGG - Intronic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1098328125 12:69323722-69323744 ATTTGGGGGTGTAGTGAAGGGGG - Intergenic
1099408933 12:82300151-82300173 ATCTGAGGTATTAGTGAAGAAGG + Intronic
1100785676 12:98075497-98075519 ATTTGGGCTTGTAGTGACTATGG + Intergenic
1101046774 12:100814788-100814810 CACTTGGTTTGAAGTGAAGATGG - Intronic
1101355881 12:103977297-103977319 AGCACAGTTTGTAGTGAAGAGGG + Intronic
1107511321 13:41088337-41088359 TTCTAGGCTTGAAGTGAAGATGG - Intergenic
1109310960 13:60692774-60692796 AGCAGGCTTTGTGGTGAAGATGG + Intergenic
1109581645 13:64347040-64347062 TTCTGTGTTTGTAGTAGAGACGG - Intergenic
1110256106 13:73435652-73435674 CACTGGGCTTATAGTGAAGAGGG - Intergenic
1110638280 13:77791334-77791356 GCCTGGGTTTGGAGTAAAGAGGG - Intergenic
1111756200 13:92398835-92398857 TTCTGGGTATGTAGTCAAGAAGG - Intronic
1111989699 13:95104282-95104304 TTTTGGGTTTTTAGTAAAGATGG + Intronic
1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG + Intergenic
1112776970 13:102854912-102854934 TTCTGTGTTTGAAGTGAAGGTGG + Intronic
1115141601 14:30177678-30177700 ATCTGGGGTTGTGGGGAGGAGGG + Intronic
1115344141 14:32324149-32324171 ATGTGGGGTGGAAGTGAAGAAGG + Intergenic
1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG + Intronic
1118115705 14:62774218-62774240 TTCTGGTTTTGTACTGGAGATGG + Intronic
1118867028 14:69712003-69712025 TTCTGGGTTTGTGGTGACGGAGG + Exonic
1119358492 14:74027255-74027277 TTTTGTGTTTGTAGTAAAGACGG + Intronic
1120104941 14:80483134-80483156 ATGTGGGTTTTTAGGGAAGGTGG - Intronic
1120512075 14:85427122-85427144 ATCTGGGTTGGGAGAAAAGAGGG - Intergenic
1129174972 15:73833285-73833307 ATCTGTGATAGGAGTGAAGATGG - Intergenic
1129457759 15:75684742-75684764 GCCTGTGTTTGTAGTGAGGATGG + Exonic
1130108001 15:80943363-80943385 TGCTGGGAGTGTAGTGAAGAGGG - Intronic
1130535499 15:84782584-84782606 TGATGGGTGTGTAGTGAAGATGG + Intronic
1130633739 15:85596670-85596692 TTCAGTGTTTGTACTGAAGATGG + Intronic
1133649660 16:7799736-7799758 ATCTGCATTTATAGTGAATAGGG + Intergenic
1134837821 16:17376654-17376676 ATTTGTGTTTTTAGTGGAGACGG - Intronic
1137638849 16:50010722-50010744 TTTTGTGTTTTTAGTGAAGATGG - Intergenic
1138565352 16:57828780-57828802 GGCTGGGCTTGTAGTGGAGAGGG - Intronic
1139489060 16:67276909-67276931 ATTTGGGGTAGTACTGAAGAGGG + Intergenic
1139988820 16:70922284-70922306 ACCTGGGTTTGCACGGAAGATGG + Intronic
1141143649 16:81514196-81514218 ATCTGGTTTTGTGGTGAAGAGGG + Intronic
1142528869 17:565229-565251 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1142913846 17:3117535-3117557 ACCTGTGTTTGGAGTGAAGTTGG + Intergenic
1143909535 17:10236294-10236316 TTTTGTGTTTTTAGTGAAGACGG - Intergenic
1143986306 17:10917577-10917599 ATTTGTGTTTTTAGTGCAGACGG + Intergenic
1144615012 17:16761386-16761408 ATATAGTTTTGTAATGAAGAAGG - Intronic
1147204447 17:38826658-38826680 TTTTGTGTTTGTAGTAAAGATGG + Intergenic
1149753290 17:59166267-59166289 ATCTGAGTTTGAAGGGAAGGAGG + Intronic
1150663797 17:67110819-67110841 ATCTGGCTTTTTACAGAAGAAGG + Intronic
1150853160 17:68725140-68725162 ATCTGGGTTCCCAGTGAGGATGG + Intergenic
1151311327 17:73294178-73294200 TTCTGTGTTTTTAGTGGAGATGG - Intronic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1156287354 18:35710879-35710901 ATCTGAGTATGGAGTGAAAAAGG - Exonic
1157233147 18:45938288-45938310 TTTTGGGTTTGTAGTAGAGACGG - Intronic
1158118958 18:54026875-54026897 TGCTGGGTTTGTAGGGAAGTAGG + Intergenic
1158454932 18:57597669-57597691 ATTTGTGTTTTTAGTGGAGACGG - Intergenic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1158651840 18:59295302-59295324 ATCTGGGTTTGTGGACTAGAAGG + Intronic
1159548112 18:69866371-69866393 TTCTGGGTTTGCAGATAAGAGGG - Intronic
1159898918 18:74023639-74023661 ATCTGCATCTGAAGTGAAGAGGG - Intergenic
1162196602 19:8989665-8989687 TTTTGTATTTGTAGTGAAGACGG - Intergenic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163882249 19:19935347-19935369 CTCTGAATTTGTAGTGATGAGGG - Exonic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163936755 19:20453357-20453379 ATCTGAATTTGTAGTGAAGAGGG + Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164014690 19:21242954-21242976 CTCTGGGTTTGTAGTGGAGTTGG - Intronic
1164031276 19:21408001-21408023 CTCTGGGTTTGTAGTGGAGTGGG + Intronic
1164102938 19:22075081-22075103 CTCTGGGTTTGTGATGGAGAGGG + Intronic
1164113359 19:22191790-22191812 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164197755 19:22986086-22986108 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164215071 19:23137758-23137780 CTCTGGGCTTATAGTGGAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1166168893 19:41012949-41012971 TTATAGGGTTGTAGTGAAGATGG - Intronic
927457023 2:23261680-23261702 ATCTGTGTTTGGAGTGAAGGTGG + Intergenic
931173073 2:59825523-59825545 ACTTGCATTTGTAGTGAAGAAGG - Intergenic
932172679 2:69571894-69571916 ACCTGGGAATGTTGTGAAGATGG + Intronic
936802811 2:116287662-116287684 ATTTGGGATTGTAGAGTAGATGG - Intergenic
939024111 2:136991491-136991513 ACCTGGGTATGCAGTGGAGAGGG + Intronic
939895670 2:147788194-147788216 ATCTAGGTTTGTAGTTAAAAAGG - Intergenic
941760738 2:169239999-169240021 CTATTGGGTTGTAGTGAAGAAGG - Intronic
942545468 2:177058764-177058786 AAGTGGATTGGTAGTGAAGATGG + Intergenic
943520125 2:188938817-188938839 ATCTGGGTTGGCAGAGAAGGGGG - Intergenic
943520352 2:188942062-188942084 AACAGGTGTTGTAGTGAAGATGG - Intergenic
944863284 2:203835825-203835847 ATCTGTGTTAGTATTGAAGCCGG - Intergenic
946731586 2:222714964-222714986 ATGTGGGTTTGCAGTGATGTGGG + Intergenic
948967100 2:241391347-241391369 AGATGGGGTTGTAGTGAAGCGGG + Intronic
1168964701 20:1892417-1892439 ATCTGGGGTGGGAGTGGAGATGG - Intergenic
1170905798 20:20514474-20514496 ATCTGGATGTGGAGTGGAGAGGG - Intronic
1171136803 20:22701947-22701969 ATCTAGGTTTGAAGTCAGGAAGG - Intergenic
1172170171 20:32925521-32925543 TTTTGGGTTTTTAGTGGAGACGG + Intronic
1173265161 20:41472463-41472485 TTATGGGTATGTGGTGAAGAAGG - Intronic
1173585921 20:44183099-44183121 ACCTTGGTTTGAAGAGAAGAGGG + Intronic
1173854486 20:46241256-46241278 ATCTGGGTAGGCAGAGAAGAAGG + Exonic
1173959487 20:47059957-47059979 AACTGTGTTTGTAGTGTAGAGGG - Intronic
1174904137 20:54532362-54532384 TTCTGTGTTTATAGAGAAGAAGG + Intronic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1184342311 22:43892586-43892608 ACTTGGGTTTGTAGTGATTAGGG + Intergenic
949926059 3:9042787-9042809 GCCTGGGATTGTAGTGAACAAGG + Intronic
954523084 3:51247241-51247263 ATGTGGGTTTGTTCAGAAGAAGG + Intronic
956149081 3:66222350-66222372 TTTTGGGTTTTTAGTGGAGACGG + Intronic
956556411 3:70528227-70528249 ATCTGGGTAGGGGGTGAAGAAGG - Intergenic
956893691 3:73638357-73638379 ATTTGGCTTTGTAGTTCAGATGG - Intergenic
958101984 3:89023792-89023814 AACTGAGTGTGCAGTGAAGAGGG - Intergenic
960025895 3:113008940-113008962 ATCTGGTGGTGTAGCGAAGAGGG - Intronic
960790445 3:121424466-121424488 TTCTGGCTTTGCAGTCAAGAAGG - Exonic
961563979 3:127750237-127750259 TTCTGGGTTTGCTGTGGAGAAGG + Intronic
963157855 3:142118199-142118221 TTCTGAATTTGTAGTGATGATGG - Intronic
963721488 3:148866925-148866947 TTTTGTGTTTTTAGTGAAGACGG + Intronic
964363421 3:155922888-155922910 ATCTGGGTTGGTAGTGCTTATGG + Intronic
964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG + Intergenic
965199689 3:165641875-165641897 ATCTGGTTCTGTTGTGGAGAAGG - Intergenic
966610955 3:181867618-181867640 CTCTGGGTTTCTAGTCATGAGGG - Intergenic
968263137 3:197340879-197340901 AGCTGGATTTGTAGTGACGCTGG + Intergenic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
968728589 4:2259529-2259551 ACGTGGGTCTGTAGTCAAGAGGG + Intronic
970667788 4:18358007-18358029 CTCTGGGATTGTAGTCAAGTGGG + Intergenic
971488103 4:27182139-27182161 TTCAGGGTTTGCAGTGAAAATGG - Intergenic
971959509 4:33467534-33467556 ATCTGGGCTTGTTGTGAAGTGGG - Intergenic
973699471 4:53522175-53522197 AGATGGGTTTGATGTGAAGAGGG - Intronic
973865403 4:55107881-55107903 ATCTGGGGTGGGACTGAAGATGG + Exonic
975257129 4:72250584-72250606 ATCTAGATTTCAAGTGAAGAAGG - Intergenic
976550879 4:86394098-86394120 ATTTGTGTTTTTAGTAAAGATGG - Intronic
976654703 4:87476481-87476503 CCCTGGGTTTGTATTTAAGATGG - Intronic
976782698 4:88778583-88778605 ATCTGGGTTTGAGATGATGATGG - Intronic
977749874 4:100596468-100596490 CTATAGGTCTGTAGTGAAGATGG - Intronic
978308686 4:107361533-107361555 AAATGGGTCTGTGGTGAAGATGG + Intergenic
979357628 4:119724148-119724170 ATATGAGATTGTAGGGAAGAAGG + Intergenic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
979904190 4:126263839-126263861 ATCAGCCTTTGTAGTGAAGTGGG - Intergenic
983563281 4:169122979-169123001 ATCTGGGTTTATAGATCAGAAGG - Intronic
984153218 4:176160490-176160512 ATTTGTATTTGTAGTGGAGATGG + Intronic
985836298 5:2274632-2274654 ATATGGATTTGTAGAGCAGATGG - Intergenic
987549859 5:19365480-19365502 TGCTGTGTTTGTAGTGATGATGG - Intergenic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
989460813 5:41696541-41696563 AACTGGGCATGTAGTGTAGAGGG + Intergenic
991510800 5:67374774-67374796 ATCTGGGATATTAGTGAATAGGG - Intergenic
991620941 5:68544984-68545006 GTCAGTGTGTGTAGTGAAGATGG - Intergenic
997055450 5:130438273-130438295 GTCTGGGTGTGAAGTGGAGAGGG + Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997713704 5:136027335-136027357 ATGTGGGGTTGTAGTCAAGGAGG - Intergenic
1000833829 5:166132490-166132512 TTCTGGGTTTTTAATAAAGAGGG + Intergenic
1001996328 5:176162398-176162420 ATCTGTGTTTCTAGGGCAGATGG + Intergenic
1005423819 6:25680033-25680055 ATCTGCGTTTGTAATAAATAAGG - Intronic
1006326279 6:33356394-33356416 TTCTGGGTTTGTGGTGACGGAGG + Intergenic
1007798098 6:44367570-44367592 ATCTGGGTGTGTGGCAAAGATGG + Intronic
1008889707 6:56473902-56473924 ATATGGGATTGTAATGAGGAAGG + Exonic
1009924389 6:70102393-70102415 CTCTTGGTTTGTGGTGATGATGG - Intronic
1009935304 6:70227031-70227053 ATTTGGGTTTATAATGAAGGTGG + Intronic
1010709808 6:79160956-79160978 ATCTGAGTTAGAACTGAAGAAGG - Intergenic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1019041623 6:169110592-169110614 ATCTCGATCTGCAGTGAAGAGGG - Intergenic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1023132479 7:37016569-37016591 ATCTGGGTTTATGTTGAAGGAGG - Intronic
1025231308 7:57204813-57204835 ATCTGTCTTTGTAGTGACCAAGG - Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1028879676 7:95865947-95865969 ATCTGGGTGTACAGTGAACAGGG + Intronic
1030124916 7:106144516-106144538 ATCAGGGCTTGTAGGGTAGATGG - Intergenic
1030138010 7:106276670-106276692 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1030666131 7:112280796-112280818 TTTTGTGTTTGTAGTGGAGATGG + Intronic
1031652710 7:124310998-124311020 ATCTGGGTGAGTAGTTGAGAAGG + Intergenic
1033395055 7:140965587-140965609 ACATGGGGTTGTTGTGAAGATGG + Intergenic
1035561431 8:607106-607128 TTCTGGTTTTCAAGTGAAGACGG + Intergenic
1039572930 8:38601614-38601636 GTCTGGCTTTGGAGTGACGAGGG + Intergenic
1041422153 8:57679600-57679622 GTATGTGTTTGTAGAGAAGATGG - Intergenic
1042164398 8:65931317-65931339 ATGTGTGTTTGTGGTGGAGATGG + Intergenic
1042497905 8:69476211-69476233 ATTTGTCTTTGTAGTGAAGAAGG - Intronic
1042895170 8:73658740-73658762 TTTTGTATTTGTAGTGAAGACGG - Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1043408227 8:79962122-79962144 AACTGCGCTTGTAGTGAGGATGG + Intronic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1043597556 8:81902621-81902643 AGATGGGTTTGTAGAAAAGAAGG + Intergenic
1044429274 8:92089686-92089708 ATCTGTTTATGTAGTGAGGAGGG - Intronic
1046200524 8:110921846-110921868 ATCTGAGTCTATAGGGAAGAAGG + Intergenic
1046392719 8:113597628-113597650 ATATTGCTTTGTTGTGAAGATGG + Intergenic
1047135696 8:122075592-122075614 ACCTGGTTATGTAGTGATGAAGG + Intergenic
1047385632 8:124406615-124406637 ATCTGTTTTTGTTTTGAAGATGG - Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1050034923 9:1424851-1424873 ATCTGGGTGTGGAGCCAAGATGG - Intergenic
1050874362 9:10615614-10615636 ATCTGCCTTTTTATTGAAGAAGG - Intergenic
1051108180 9:13604258-13604280 ATTTTGGTTCTTAGTGAAGAAGG + Intergenic
1056239581 9:84631153-84631175 GTCTGGGTTTTCAGTGAAGCAGG + Intergenic
1059916010 9:119101197-119101219 ATCTGGGTTAGAGGTGAAGTGGG - Intergenic
1060511332 9:124235722-124235744 AACTGTGTTTGTAGAGAACATGG + Intergenic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1062405265 9:136393220-136393242 GTCAGGGTTTGCAGTGATGACGG - Intronic
1185582071 X:1217363-1217385 ATTTGTATTTTTAGTGAAGACGG - Intergenic
1185781939 X:2855389-2855411 ATATGGGTTTGTAGCCTAGAAGG - Intronic
1186221131 X:7350302-7350324 AGGCGTGTTTGTAGTGAAGATGG - Exonic
1190497314 X:51039339-51039361 TCCAGGGTTTATAGTGAAGATGG - Intergenic
1190902821 X:54695249-54695271 ACCAGGGTTTTTATTGAAGATGG - Intergenic
1191640513 X:63426672-63426694 GTCTGGGATTGTTGTGAAAATGG + Intergenic
1192333246 X:70197032-70197054 AATTTAGTTTGTAGTGAAGATGG - Intronic
1192507593 X:71698397-71698419 TTCTGGGTTTGTGGTGACGGAGG + Intergenic
1192519103 X:71783155-71783177 TTCTGGGTTTGTGGTGACGGAGG - Intergenic
1194024592 X:88736055-88736077 GTCTGGGTGTGTAGCAAAGAGGG + Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1197050070 X:122046966-122046988 ACCTGGCTTTGTAGTGAACAGGG - Intergenic
1197088314 X:122506458-122506480 ATTTGGCTTTCTATTGAAGAAGG + Intergenic
1198737414 X:139802057-139802079 TTCTGGGTTGATAGTGAACAAGG + Intronic
1199322359 X:146455586-146455608 ACCTGGGATTGTGGTGCAGAGGG + Intergenic
1200748537 Y:6923687-6923709 ATCTGTATTTTTAGTGGAGACGG + Intronic
1200806522 Y:7438969-7438991 ATCTGTGTTTGTCTTGCAGATGG + Intergenic
1201298365 Y:12485243-12485265 ACCTGGGTTTGCAGTGTGGATGG + Intergenic