ID: 1164243394

View in Genome Browser
Species Human (GRCh38)
Location 19:23409725-23409747
Sequence TTAGAGGCTGGCTGCGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164243394_1164243402 14 Left 1164243394 19:23409725-23409747 CCACCTCCGCAGCCAGCCTCTAA No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164243394 Original CRISPR TTAGAGGCTGGCTGCGGAGG TGG (reversed) Intergenic
No off target data available for this crispr