ID: 1164243402

View in Genome Browser
Species Human (GRCh38)
Location 19:23409762-23409784
Sequence CTTCCTAAGCTTTGAATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164243396_1164243402 8 Left 1164243396 19:23409731-23409753 CCGCAGCCAGCCTCTAAGTCTGC No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data
1164243389_1164243402 27 Left 1164243389 19:23409712-23409734 CCCCCAAGGCGGCCCACCTCCGC No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data
1164243394_1164243402 14 Left 1164243394 19:23409725-23409747 CCACCTCCGCAGCCAGCCTCTAA No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data
1164243398_1164243402 -2 Left 1164243398 19:23409741-23409763 CCTCTAAGTCTGCCGACCTTCCT No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data
1164243391_1164243402 25 Left 1164243391 19:23409714-23409736 CCCAAGGCGGCCCACCTCCGCAG No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data
1164243397_1164243402 2 Left 1164243397 19:23409737-23409759 CCAGCCTCTAAGTCTGCCGACCT No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data
1164243393_1164243402 15 Left 1164243393 19:23409724-23409746 CCCACCTCCGCAGCCAGCCTCTA No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data
1164243390_1164243402 26 Left 1164243390 19:23409713-23409735 CCCCAAGGCGGCCCACCTCCGCA No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data
1164243395_1164243402 11 Left 1164243395 19:23409728-23409750 CCTCCGCAGCCAGCCTCTAAGTC No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data
1164243392_1164243402 24 Left 1164243392 19:23409715-23409737 CCAAGGCGGCCCACCTCCGCAGC No data
Right 1164243402 19:23409762-23409784 CTTCCTAAGCTTTGAATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164243402 Original CRISPR CTTCCTAAGCTTTGAATCCC TGG Intergenic
No off target data available for this crispr