ID: 1164243425

View in Genome Browser
Species Human (GRCh38)
Location 19:23409870-23409892
Sequence GGCCTGCAGGGTGGACACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164243425_1164243431 12 Left 1164243425 19:23409870-23409892 CCAACGTGTCCACCCTGCAGGCC No data
Right 1164243431 19:23409905-23409927 CGCCCCTGAAAACGTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164243425 Original CRISPR GGCCTGCAGGGTGGACACGT TGG (reversed) Intergenic
No off target data available for this crispr