ID: 1164249211

View in Genome Browser
Species Human (GRCh38)
Location 19:23462273-23462295
Sequence CTCTCTCATTGGCAAGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164249211_1164249213 5 Left 1164249211 19:23462273-23462295 CCTTCAACTTGCCAATGAGAGAG No data
Right 1164249213 19:23462301-23462323 GTCTCTTATAGCTAAGCTTAAGG No data
1164249211_1164249214 23 Left 1164249211 19:23462273-23462295 CCTTCAACTTGCCAATGAGAGAG No data
Right 1164249214 19:23462319-23462341 TAAGGAAAAAGATAAGATCCTGG No data
1164249211_1164249215 24 Left 1164249211 19:23462273-23462295 CCTTCAACTTGCCAATGAGAGAG No data
Right 1164249215 19:23462320-23462342 AAGGAAAAAGATAAGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164249211 Original CRISPR CTCTCTCATTGGCAAGTTGA AGG (reversed) Intergenic
No off target data available for this crispr