ID: 1164256337

View in Genome Browser
Species Human (GRCh38)
Location 19:23531530-23531552
Sequence TATCACAGGGCCCAGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 21, 3: 85, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164256337_1164256341 10 Left 1164256337 19:23531530-23531552 CCTGGATGCTGGGCCCTGTGATA 0: 1
1: 0
2: 21
3: 85
4: 392
Right 1164256341 19:23531563-23531585 CTTTCCTGTAATAAAGACCCAGG 0: 4
1: 0
2: 1
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164256337 Original CRISPR TATCACAGGGCCCAGCATCC AGG (reversed) Intronic
902223122 1:14979447-14979469 GATTGCAGGGCCCAGCATGCTGG - Intronic
904076509 1:27846881-27846903 TAGCACAATGCCCAGCACCCAGG + Intronic
904787491 1:32993713-32993735 AATCACAGGGCCCAGGACCCTGG - Intergenic
906798398 1:48715414-48715436 TAGCACAGGGCCTGGCACCCAGG - Intronic
906822477 1:48944038-48944060 TATCACAGGGCCTGGCATATGGG - Intronic
907274716 1:53310828-53310850 CATCACAGGGCCCAGCACAGAGG - Intronic
912375303 1:109204780-109204802 TTTCACTGGGCCCAGCATGGTGG + Intronic
912550255 1:110480761-110480783 TACCACAAGGCCCCTCATCCTGG - Intergenic
915316699 1:155032882-155032904 TCTCCCAGGCCCCAGAATCCAGG - Intronic
919464106 1:197911136-197911158 CATCACCGGGACCAGCATCTTGG + Intergenic
919878860 1:201889226-201889248 CCTCCCATGGCCCAGCATCCTGG - Intronic
920917907 1:210272896-210272918 TATCACAGCCCTCAGCCTCCCGG + Intergenic
921831771 1:219735114-219735136 TCTGACGGTGCCCAGCATCCAGG + Intronic
922768119 1:228166382-228166404 TCACCCAGGGCCCAGCACCCGGG + Intronic
923401106 1:233615618-233615640 AATCACAAGGCCCAGGTTCCAGG - Intronic
923788991 1:237094946-237094968 TAGCACAGGGCAAGGCATCCAGG - Intronic
924856038 1:247876015-247876037 TGACACATGGCCCTGCATCCTGG + Exonic
1063563450 10:7150402-7150424 TCTCACAGGGCCAAGCATGGTGG - Intergenic
1067082942 10:43221790-43221812 TGTCACAGGGCCCAGCAGGTGGG - Intronic
1067109261 10:43387864-43387886 TCCCTCAGGGCCCAGCATCATGG + Exonic
1067489502 10:46685013-46685035 TCTCTCAGGGCTCAGCAGCCTGG - Intergenic
1067605166 10:47655371-47655393 TCTCTCAGGGCTCAGCAGCCTGG + Intergenic
1067684882 10:48460081-48460103 CAGCCCAGGGCCCAGCCTCCTGG - Intronic
1069016059 10:63430807-63430829 GATCACAGGTCACCGCATCCTGG + Intronic
1069366366 10:67698385-67698407 TAACACAGGGCTCTGCATCAAGG - Intergenic
1070557346 10:77538886-77538908 TAGCACAGGGCTCAGCATGAAGG + Intronic
1071121963 10:82288512-82288534 TCCCACACGGCACAGCATCCTGG - Intronic
1071620725 10:87116770-87116792 TCTCTCAGGGCTCAGCAGCCTGG + Intronic
1073810365 10:107145994-107146016 TACCACTGGGGCAAGCATCCTGG + Intronic
1074412875 10:113243228-113243250 TCTCCCAGGGCCCAGCCTCTGGG - Intergenic
1074756610 10:116628306-116628328 TATCACAGCTCCCTGCAGCCTGG - Intronic
1074946094 10:118282044-118282066 CAGCACAGGGACCAGAATCCAGG + Intergenic
1075834587 10:125442968-125442990 TGTCACTGGGCCCAGCACCCTGG + Intergenic
1079682196 11:23311654-23311676 TATCACAGGGCCAAGTATGGTGG - Intergenic
1080268517 11:30425840-30425862 TCTCACAGTTCCCATCATCCAGG + Intronic
1083304266 11:61754567-61754589 TCTGTCAGGGCCCAGCGTCCTGG - Intronic
1083332885 11:61907204-61907226 GATCACAGGGCCCAGTGTCCCGG - Intronic
1083503590 11:63134066-63134088 TTTCACAAGGATCAGCATCCAGG + Intronic
1084680434 11:70663362-70663384 GATGACAGGGCTCAGTATCCTGG + Intronic
1085641295 11:78194770-78194792 TAGCACAGTGCCCAGCAGACAGG - Intronic
1087922864 11:103886649-103886671 CATACCAGGGCACAGCATCCTGG - Intergenic
1090984150 11:131750926-131750948 AATCCCAGGGGCCTGCATCCAGG + Intronic
1091225018 11:133951800-133951822 TACCACGGAGCCCAGCCTCCTGG - Intronic
1092047651 12:5443380-5443402 CAGCACAGGGCCCTGCATCCAGG - Intronic
1092663381 12:10764693-10764715 GATCCCATGGCCCAGGATCCAGG - Intergenic
1096876348 12:54633174-54633196 ACTCACAGGTCCCAGCTTCCTGG + Exonic
1103245195 12:119450903-119450925 TCTCACAGAGCCCTGCAGCCTGG + Intronic
1103507209 12:121449570-121449592 TATAACTGGGCCCAGCACACGGG + Intronic
1103701820 12:122852042-122852064 TCTCAGAGGGCTCAGCTTCCAGG + Intronic
1104469054 12:129014209-129014231 TATCACAGAGACCAGCTTACTGG + Intergenic
1105865951 13:24460049-24460071 CATCACAGAACTCAGCATCCTGG - Exonic
1106176492 13:27336631-27336653 GAGCACAGGGCCCAGTCTCCGGG + Intergenic
1106794253 13:33188069-33188091 TTTCCCATGGCCCAGCAACCAGG - Intronic
1110308204 13:74015427-74015449 TATCACAGTGCCCAGCACATAGG + Intronic
1112439584 13:99416171-99416193 TCCAGCAGGGCCCAGCATCCTGG - Intergenic
1113681377 13:112247470-112247492 GATCACTGGGCCCTGCAGCCAGG + Intergenic
1113854814 13:113437354-113437376 TACCCCAGGACCCAGCACCCAGG + Intronic
1117301579 14:54434608-54434630 TACCACAGAGCCTAGCACCCAGG + Intronic
1119431965 14:74574378-74574400 TAGCACAGGGACCAGCACCCAGG - Intronic
1120021120 14:79531435-79531457 TATGACATGGCACAGTATCCAGG + Intronic
1120518364 14:85496684-85496706 TAACACAGGACTCAGCATCAAGG + Intergenic
1121330894 14:93049270-93049292 TAGCACAGAGCCCTGCATGCAGG - Intronic
1121335251 14:93074002-93074024 GCTCCCAGGGCCCAGCAGCCTGG + Intronic
1121648350 14:95536104-95536126 TAGCCCAGGGCCCAGGAGCCAGG - Intronic
1122479380 14:102036558-102036580 GATCACACGGACCAGCTTCCTGG + Exonic
1122848461 14:104513567-104513589 TATCCCCGGGCCCAGCCACCCGG - Intronic
1124085149 15:26542620-26542642 TATCACTGGGCCCCACATGCAGG + Intergenic
1124816131 15:32994641-32994663 TAGCACAGTGCCTGGCATCCAGG + Intronic
1128509698 15:68305836-68305858 TAGCACACAGCCCAGCATACAGG + Intronic
1128618221 15:69126948-69126970 AAACACAGGGCCCAGCATGGTGG + Intergenic
1128713432 15:69889103-69889125 TATCAGTGTGCCCAGGATCCAGG + Intergenic
1128995658 15:72292542-72292564 TACCACATGGACCAGAATCCAGG + Intronic
1129779894 15:78263709-78263731 TAACACTGGGCCCAACAGCCTGG + Intergenic
1130202186 15:81842433-81842455 GAGCACACGGCCCAGCATCCAGG + Intergenic
1131303913 15:91224367-91224389 TATCAGAGGGTCCAGCAGCTGGG + Intronic
1131578101 15:93612398-93612420 TATGGCAGGGCCCAGAAGCCAGG + Intergenic
1131873336 15:96781877-96781899 TATCTCAGGGCCCAGTGCCCTGG - Intergenic
1133056591 16:3148429-3148451 TTACACAGGGCCCAGCTTCCTGG + Intronic
1134180836 16:12046471-12046493 TGTCACAAGGCCCTGCACCCTGG - Intronic
1136714402 16:32265251-32265273 TACCACTGGGCCAAGCACCCAGG + Intergenic
1136753487 16:32664166-32664188 TACCACTGGGCCAAGCACCCAGG - Intergenic
1136814626 16:33206199-33206221 TACCACTGGGCCAAGCACCCAGG + Intronic
1136821102 16:33316279-33316301 TACCACTGGGCCAAGCACCCAGG + Intergenic
1136827665 16:33372818-33372840 TACCACTGGGCCAAGCACCCAGG + Intergenic
1136832731 16:33471589-33471611 TACCACTGGGCCAAGCACCCAGG + Intergenic
1137009345 16:35308114-35308136 TATCACTGAGCCTAGCACCCAGG - Intergenic
1137009353 16:35308185-35308207 TATCACTGGGCCAAGCAGCAAGG - Intergenic
1137015026 16:35365869-35365891 TATCACCAGGCCCAGCTCCCAGG - Intergenic
1137023221 16:35450862-35450884 TATCACTGAGCCAAGCACCCAGG - Intergenic
1137023233 16:35450932-35450954 TACCACTGGGCCAAGCACCCAGG - Intergenic
1137028024 16:35498045-35498067 TATCACAGAGCCAAGCATCCAGG - Intergenic
1137028035 16:35498116-35498138 TAGCACTGGGCCAAGCACCCAGG - Intergenic
1137034902 16:35561644-35561666 TACCACTGGGCCAAGCACCCAGG - Intergenic
1137035712 16:35568074-35568096 TATCAATGGGCCAAGCACCCTGG - Intergenic
1137036066 16:35570961-35570983 TATCCCTGAGCCCAGCACCCAGG - Intergenic
1139026562 16:62824974-62824996 TCTACCAGGGCCCAGCATCAGGG + Intergenic
1140102320 16:71928342-71928364 AATGAGAGGGCCCAGCTTCCAGG - Exonic
1140450257 16:75064927-75064949 CCTCACAGGGCCCAGCAAACTGG + Intronic
1142025726 16:87812442-87812464 TGTCTCAGGCCCCAGCAGCCTGG - Intergenic
1202993202 16_KI270728v1_random:29173-29195 TACCACTGGGCCAAGCACCCAGG + Intergenic
1203055648 16_KI270728v1_random:924518-924540 TACCACTGGGCCAAGCACCCAGG - Intergenic
1143610351 17:8014433-8014455 AAACACAGTGCCCAGCACCCCGG + Intronic
1144546480 17:16200919-16200941 TATTACAGAGCCCAGCATGCAGG + Intronic
1144710124 17:17396036-17396058 ACGCACAGGGCCCTGCATCCAGG - Intergenic
1145299898 17:21626396-21626418 TATTACAGAGTCCAGCATCCAGG - Intergenic
1145350384 17:22076869-22076891 TATTACAGAGTCCAGCATCCAGG + Intergenic
1145955653 17:28852718-28852740 TATCCAAGGGTTCAGCATCCAGG + Intronic
1147745584 17:42692484-42692506 CATCACACTGTCCAGCATCCCGG + Exonic
1147769243 17:42856442-42856464 CCTCGCAGGCCCCAGCATCCTGG - Exonic
1147771977 17:42874261-42874283 CCTCGCAGGCCCCAGCATCCTGG - Intergenic
1148775196 17:50091321-50091343 TGTCACAAGGTCCAGCCTCCAGG + Intergenic
1149667545 17:58376136-58376158 TCTCCCAGGGGCCAGCCTCCTGG - Intronic
1150438159 17:65170012-65170034 TAGCACAGTGCCCAGCACACTGG - Intronic
1151232690 17:72696029-72696051 TTTCACCACGCCCAGCATCCAGG - Intronic
1152723468 17:81934086-81934108 GAGCACAGGGCACAGCATCCGGG + Intronic
1152830733 17:82495745-82495767 TCTCACAGGGTCCAGGCTCCTGG - Intergenic
1203163587 17_GL000205v2_random:74054-74076 TATCACAGGGCCCAGCACACAGG - Intergenic
1203164038 17_GL000205v2_random:77716-77738 CATCACAGGGCCCAGAACACAGG - Intergenic
1203164148 17_GL000205v2_random:78553-78575 TATCATCGGGCCCAGCACCTGGG - Intergenic
1153002065 18:464719-464741 AATCCCAGGGTCCAGCATCAGGG + Intronic
1153762135 18:8341581-8341603 AATCAGAGGTCCCAGCATCATGG - Intronic
1153835880 18:8963251-8963273 CATCTCAGGGCGCAGCATCTGGG + Intergenic
1157824188 18:50797730-50797752 TTTCAAAGAGGCCAGCATCCGGG + Intronic
1162458942 19:10803020-10803042 TATCACAGGGCCCAGCGAGAGGG - Intronic
1163987450 19:20967100-20967122 TATCACTGGGCCCAGAACCTAGG + Intergenic
1163987725 19:20968924-20968946 TAACACTGGGCCCAGCACCTAGG + Intergenic
1164040478 19:21488616-21488638 TATCACTGAGCCCAGCAGCTAGG + Intronic
1164041129 19:21493643-21493665 TATCACTGAGCCCAGCACCCAGG + Intergenic
1164041383 19:21495688-21495710 TGTAACAGGGCCCAGCACACAGG + Intergenic
1164041482 19:21496559-21496581 TATCACTGGGCCCCTCACCCTGG + Intergenic
1164041694 19:21498253-21498275 TATCACTGGACCCAGCACCTTGG + Intronic
1164052465 19:21595020-21595042 TATCACTGGACCCAGCATCTAGG + Intergenic
1164052801 19:21597555-21597577 TATCACTGGGCCCTGCACACAGG + Intergenic
1164078129 19:21839126-21839148 TATCACTGGACCCAGCACCTAGG - Intronic
1164078294 19:21840715-21840737 TATAACAGGGCCTAGCACCCAGG - Intronic
1164078321 19:21841068-21841090 TATCATAGGGCCAAGCACACAGG - Intronic
1164078580 19:21843144-21843166 TATCACTGGTCCCTGCACCCAGG - Intronic
1164079062 19:21847066-21847088 TATCTCTGGGCCCAGCATCCAGG - Intronic
1164079266 19:21848601-21848623 TATCACTGGTCCCAGCACCTAGG - Intronic
1164082779 19:21875101-21875123 TATCTCTGGGCCCAGCACACAGG + Intergenic
1164082918 19:21876049-21876071 TATCGCTGGGCCCAGCACCCAGG + Intergenic
1164082927 19:21876121-21876143 TATCACTGTGCCCAACACCCAGG + Intergenic
1164083200 19:21878460-21878482 CATCACTGGGCCCAGCACACAGG + Intergenic
1164083259 19:21878897-21878919 TATCACTGGGCCCAGCATGCAGG + Intergenic
1164087365 19:21915574-21915596 TATCACTGGAACCAGCATCCAGG + Intergenic
1164087403 19:21915968-21915990 CATCACAGGGCCCAGCGCACAGG + Intergenic
1164088113 19:21922477-21922499 TATCACTGGGCTCAGGACCCAGG + Intergenic
1164089182 19:21932744-21932766 TATCACTGGGCCCAGCATCTAGG + Intergenic
1164089536 19:21935921-21935943 TATCACTGGGCCCATCACCTAGG + Intronic
1164098027 19:22029340-22029362 TATCACAGGGTCCAGCACACAGG - Intergenic
1164098040 19:22029415-22029437 TATCACTGGGCCCAGCACCCAGG - Intergenic
1164098290 19:22031481-22031503 TATCACTGGGCCCAGCAACAAGG - Intergenic
1164098386 19:22032198-22032220 TATCTCTGGGCCCAGCACCTAGG - Intergenic
1164098613 19:22034376-22034398 TATCACTGGGCTCAGCCCCCAGG - Intergenic
1164098625 19:22034447-22034469 TATCGCTGGGCCCAGTAACCAGG - Intergenic
1164098701 19:22035097-22035119 TATCACTGGGCCCAGCACACAGG - Intergenic
1164098819 19:22036089-22036111 TATCACTGGACCCAGCACCTAGG - Intergenic
1164099223 19:22039742-22039764 TATCTCTGGGCCCAGCACCTAGG - Intergenic
1164099387 19:22041354-22041376 TATCACTGGGCTCAGCACCCAGG - Intergenic
1164099474 19:22041982-22042004 TATCACTGAACCCAGCATCTAGG - Intergenic
1164099914 19:22045500-22045522 TATCACTGGGCCCAACTTCAAGG - Intergenic
1164100368 19:22049622-22049644 CATCACAGGGCCCAGCACACAGG - Intergenic
1164117952 19:22240232-22240254 TATCACAGGGTCCAGCACACAGG - Intergenic
1164117965 19:22240307-22240329 TATCACTGGGCCCAGCACCCAGG - Intergenic
1164118128 19:22241591-22241613 CCTCACAGGGCCCAGCACACAGG - Intergenic
1164118500 19:22244676-22244698 TATCGCTGGGCCCAGTAACCAGG - Intergenic
1164118700 19:22246313-22246335 TATCACTGGACCCAGCACCTAGG - Intergenic
1164119583 19:22254234-22254256 TATCACTGGGCTCAGCACCCAGG - Intergenic
1164119674 19:22254862-22254884 TATCACTGAACCCAGCATCTAGG - Intergenic
1164119854 19:22256425-22256447 TATCACTGGGCTCAGCACCCAGG - Intergenic
1164120030 19:22257662-22257684 TATCACTGGGCCCAGCACCTAGG - Intergenic
1164120117 19:22258405-22258427 TATCACTGGGCCCAACACCAAGG - Intergenic
1164120157 19:22258695-22258717 TATCACTGCACCCAACATCCAGG - Intergenic
1164120299 19:22259961-22259983 TATCACAGGATCCAGCACCTAGG - Intergenic
1164126589 19:22324010-22324032 TATCACTGGGCCCAGCACACAGG + Intergenic
1164126765 19:22325533-22325555 TATAACATGGCTCAGCACCCAGG + Intergenic
1164127088 19:22328335-22328357 TTTCACAGGGCCCAGCAGACAGG + Intergenic
1164127218 19:22329457-22329479 TATGACTGGGCCCAGCACACAGG + Intergenic
1164127349 19:22330649-22330671 TATTACAGGGGCCAGCACACAGG - Intergenic
1164127403 19:22331151-22331173 TATCACTGGTCACAGCATGCAGG - Intergenic
1164128046 19:22336507-22336529 TATCACTGGGCCCAGCACCTAGG - Intergenic
1164129158 19:22346294-22346316 TATCACTGGGCCCAACACCTAGG + Intergenic
1164129171 19:22346370-22346392 TAGCACTGGGCCTAGCACCCAGG + Intergenic
1164129487 19:22348885-22348907 TATCACTGGGCCCAGCACATAGG + Intergenic
1164169802 19:22715310-22715332 TATCTCTGGGCCCAGCACCTAGG - Intergenic
1164170059 19:22717110-22717132 TATCGCTGGGCCCAGCACCTAGG - Intergenic
1164170466 19:22720487-22720509 TACCACTGGGCCCAGCACCTAGG - Intergenic
1164171450 19:22728885-22728907 CATCACTGGGCCCAGCACCTAGG + Intergenic
1164172377 19:22736484-22736506 TATCACTGGGCCCTGCACCCAGG - Intergenic
1164172806 19:22740205-22740227 TATCACTGGACCCAGCACCTAGG - Intergenic
1164180125 19:22811068-22811090 TATAACAGGGCCCAATATCTAGG + Intergenic
1164180193 19:22811529-22811551 TATCACTGGGCCCAGCACCCAGG + Intergenic
1164180238 19:22811943-22811965 CATCACAGGGCCCAGCACACAGG + Intergenic
1164180607 19:22815125-22815147 TATCACTGGGCCCAGAATCTAGG + Intergenic
1164180873 19:22817468-22817490 TATCACTGGGCCCAGCAATTAGG + Intergenic
1164180919 19:22817867-22817889 CATCACAGGGCCCAGCACACAGG + Intergenic
1164181010 19:22818806-22818828 TATCACTGAACCCAGCACCCAGG + Intergenic
1164181165 19:22820041-22820063 TATCACTGGACCAAGCACCCAGG + Intergenic
1164181805 19:22825718-22825740 TATCACTGGGCCCAGCACCCAGG + Intergenic
1164181853 19:22826088-22826110 TATCACTGGGCTGAGCATCCAGG + Intergenic
1164190758 19:22915220-22915242 TATCACTGAGCCCAGCACACAGG + Intergenic
1164190900 19:22916168-22916190 TATCGCTGGGCCCAGCACCCAGG + Intergenic
1164190910 19:22916240-22916262 TATCACTGTGCCCAACACCCAGG + Intergenic
1164193446 19:22932545-22932567 CATCACTGGGCCCAGCACCTAGG + Intergenic
1164200983 19:23018380-23018402 TATCACAGGGTCCAGCACACAGG - Intergenic
1164200996 19:23018460-23018482 TATCACTGGGCCCAGAACCCAGG - Intergenic
1164201235 19:23020552-23020574 TATCACTGGGCCCAGTAACAAGG - Intergenic
1164201327 19:23021278-23021300 TATCTCTGGGCCCAGCACCTAGG - Intergenic
1164201657 19:23024166-23024188 TATCACTGGGCCCAGCACACAGG - Intergenic
1164201780 19:23025142-23025164 TATCACTGGACCCAGCACCTAGG - Intergenic
1164204577 19:23047560-23047582 TATCACTGGACCTAGCATCTAGG - Intergenic
1164204968 19:23050678-23050700 TATCACTAGGCCCAGCACCCAGG - Intergenic
1164205146 19:23052311-23052333 TATGACTGGGCCCGGCATCCAGG - Intergenic
1164205776 19:23057463-23057485 TATCACTGGGCCATGCACCCAGG - Intergenic
1164206439 19:23062876-23062898 CATAACAGGGCCCAGCAAACAGG - Intergenic
1164206846 19:23066150-23066172 TATCACTGGGCCTAGTACCCAGG - Intergenic
1164227171 19:23256080-23256102 TATCACTAGGCCCAGCATCTAGG - Intergenic
1164233970 19:23316136-23316158 TATCACTTGACCCAGCATCTAGG + Intronic
1164242922 19:23406138-23406160 TATCACTGGGCCTAGCATCCAGG - Intergenic
1164255378 19:23523783-23523805 TATCACTGGGCCCAGCACCTTGG - Intergenic
1164256168 19:23530121-23530143 TATCACTGGGCTCAGCACCCAGG - Intronic
1164256337 19:23531530-23531552 TATCACAGGGCCCAGCATCCAGG - Intronic
1164257701 19:23543648-23543670 TATCTCCTGGCCCACCATCCAGG - Intronic
1164260253 19:23563142-23563164 TATCACAGGGCACAGCACATTGG - Intronic
1164281169 19:23769979-23770001 TATCACTGGGCCCAGCACCTAGG + Intronic
1164281262 19:23770711-23770733 TATCACTGGGCCTAGCATCTAGG + Intronic
1164281398 19:23771964-23771986 TATCACTAGGCCCAGCACCTAGG + Intronic
1164283156 19:23787022-23787044 TATTACTGGGCCCAGCATCCAGG + Intronic
1164293654 19:23889745-23889767 TATTGCTGGGCCCAGCAACCAGG + Intergenic
1164294465 19:23897506-23897528 TATCACTAGGCCCAGCTACCAGG + Intergenic
1164294646 19:23899110-23899132 TATTACTGAGCCCAGCATCCAGG + Intergenic
1164294869 19:23901029-23901051 TATCACTGGGCCCAGCACCTAGG + Intergenic
1164295555 19:23906654-23906676 TATCACTGGTCCCTGCACCCAGG + Intergenic
1164303663 19:23984374-23984396 TATCATTAGGCCCAGCAACCAGG - Intergenic
1164311683 19:24051505-24051527 TATTGCTGGGCCCAGAATCCGGG + Intronic
1164311722 19:24051796-24051818 TATCACTGGGCCCAGCACATAGG + Intronic
1164311826 19:24052589-24052611 TGTCACTGGGCCTAGCATCCAGG + Intronic
1164311917 19:24053546-24053568 TATCACAGGGCCTAGTGCCCAGG + Intronic
1164311955 19:24053840-24053862 TATCACTGGACCCAGCATCTAGG + Intronic
1164312460 19:24058355-24058377 TATCACTGGGCCTTGCATCCAGG + Intronic
1164313682 19:24068251-24068273 TATCACTGGGCCCAGCACACAGG + Intronic
1164313992 19:24070846-24070868 TATCACTGGTCCCTGCACCCAGG + Intronic
1164324868 19:24182302-24182324 TATCCCTGGGCCCAGCACACAGG - Intergenic
1164325286 19:24185919-24185941 TATCACTGGGCCCCACACCCAGG - Intergenic
1164561042 19:29292469-29292491 TATCTCAGGGCTGAGTATCCAGG + Intergenic
1165015955 19:32880056-32880078 CACCACAGGGCACTGCATCCTGG - Intronic
1165227108 19:34362683-34362705 TCTCACAGTGCCCAGGTTCCTGG - Intronic
1165683010 19:37793399-37793421 AATGAGAGGGCCCAGCTTCCAGG - Intronic
1165926794 19:39331401-39331423 TTGCACAGGGCCCCGCACCCAGG - Intronic
1168069496 19:53941904-53941926 TATCCCAGGACCCAGGATCAGGG - Intronic
1168231193 19:55032590-55032612 TATCACCGCGCCCAGCAGGCAGG - Intronic
926861792 2:17317594-17317616 GATCCCAGGGCACAGGATCCTGG + Intergenic
929263563 2:39893851-39893873 GACCACAGTGCCCAGCCTCCAGG + Intergenic
930832451 2:55759563-55759585 TATCCCAGGGCCCAGGTACCAGG + Intergenic
931621284 2:64212206-64212228 TATCTGTGGGCCCAGCATGCGGG + Intergenic
934972633 2:98775337-98775359 GAACACAGTGCACAGCATCCGGG - Intergenic
935329982 2:101969776-101969798 GAACACACGTCCCAGCATCCTGG - Intergenic
938187329 2:129243156-129243178 TATCACTGGGCCGAGCACCTAGG - Intergenic
939024385 2:136994596-136994618 TATCTCAGGACTCAGCACCCAGG - Intronic
941474912 2:165939241-165939263 TATCTCAGGGCCGAACATCTTGG - Intronic
943079493 2:183241150-183241172 GATCACAGAGCCCACCACCCTGG + Intergenic
944486611 2:200213521-200213543 TAGTGCAGGGCCCAGCACCCAGG + Intergenic
944906955 2:204271450-204271472 TAGCACAGTGCCTAGCATGCAGG + Intergenic
946246450 2:218390552-218390574 TCCCACAGGGCTCAGCATTCAGG - Intronic
947179285 2:227397877-227397899 TACCCCAGGGCCTAGAATCCTGG - Intergenic
947470363 2:230396015-230396037 GACCACAGGGCCCAGAGTCCTGG - Intronic
947722456 2:232378281-232378303 TCCCACAGGGCCCAGGCTCCTGG + Intergenic
947861414 2:233361095-233361117 TCTCACAGGGCTCAGCCTCTTGG - Intronic
948613553 2:239184608-239184630 CATCATAGGGCACAGCCTCCAGG - Intronic
948898051 2:240936687-240936709 TATCACTGGGACCAGCACCCAGG + Intronic
1170161327 20:13314506-13314528 TTTCACAGGGCACAGGATCTAGG - Intergenic
1171560640 20:26121876-26121898 TATTACTGAGTCCAGCATCCAGG + Intergenic
1171794465 20:29555868-29555890 TATGACTGAGCCCAGAATCCAGG + Intergenic
1171854001 20:30328523-30328545 TATGACTGAGCCCAGAATCCAGG - Intergenic
1172695178 20:36817546-36817568 TGTCACAGTGCCCAGGGTCCAGG + Intronic
1173137317 20:40450207-40450229 TATCACCAGGCCAAGAATCCTGG + Intergenic
1173527914 20:43746994-43747016 TATCCCAGCTCCCAGCTTCCTGG + Intergenic
1174007347 20:47421050-47421072 TTTCACAGGGCCCAGGGCCCAGG + Intergenic
1174508170 20:51030535-51030557 AAGCACAGGGCCCACCAGCCAGG + Intergenic
1174849226 20:53975935-53975957 TAGCACAGGGGCCAGCAGCAGGG + Intronic
1175316733 20:58053948-58053970 GATCACAGGGCTGAGGATCCTGG - Intergenic
1176337523 21:5612688-5612710 TATCACTGGGCCCAGAACCCAGG + Intergenic
1176337565 21:5613083-5613105 CATCACAGGGCCCAGAACACAGG + Intergenic
1176338014 21:5616909-5616931 TATCACAGGGCCCAGCACACAGG + Intergenic
1176339422 21:5679982-5680004 TATCACAGGGCCCAGCACACAGG + Intergenic
1176471185 21:7107914-7107936 TATCACTGGGCCCAGAACCCAGG + Intergenic
1176471227 21:7108309-7108331 CATCACAGGGCCCAGAACACAGG + Intergenic
1176471676 21:7112135-7112157 TATCACAGGGCCCAGCACACAGG + Intergenic
1176494746 21:7489692-7489714 TATCACTGGGCCCAGAACCCAGG + Intergenic
1176494788 21:7490087-7490109 CATCACAGGGCCCAGAACACAGG + Intergenic
1176495237 21:7493913-7493935 TATCACAGGGCCCAGCACACAGG + Intergenic
1176505405 21:7644474-7644496 TATCACAGGGCCCAGCACACAGG - Intergenic
1176505854 21:7648296-7648318 CATCACAGGGCCCAGAACACAGG - Intergenic
1176505896 21:7648691-7648713 TATCACTGGGCCCAGAACCCAGG - Intergenic
1176650516 21:9542545-9542567 TATTACAGAGTCCACCATCCAGG - Intergenic
1179906582 21:44426099-44426121 CATCCCAGGGCCCAGCCCCCCGG + Intronic
1181044213 22:20206988-20207010 AAGCCCAGGGCCCAGCATACAGG - Intergenic
1181362902 22:22352623-22352645 GAGCACAGGGCCCAGCCTCAAGG - Intergenic
1181365706 22:22375696-22375718 GAGCACAGGGCCCAGCCTCAAGG - Intergenic
1181777125 22:25167885-25167907 TAGAACAGGGCCCAGCACTCAGG - Intronic
1183464417 22:37972572-37972594 AGACACAGGGCCCAGCACCCAGG - Exonic
1183953593 22:41366562-41366584 GACCACAGGGGCCAGCGTCCTGG + Intergenic
1184343722 22:43900498-43900520 TAACCCAGGGCCCAGCAGCCAGG + Intergenic
953097308 3:39791228-39791250 TAGAACAGGGCCCAGCATATAGG - Intergenic
959633651 3:108536865-108536887 TATCAAAGAACACAGCATCCTGG + Intergenic
961127725 3:124435635-124435657 CATCAGAGGGCCCTGCAGCCAGG + Intronic
965222019 3:165938106-165938128 TATCACAGGGCCAAATATCATGG - Intergenic
965816681 3:172643718-172643740 TACCACAGGGCCTACCCTCCGGG - Intronic
966186161 3:177228830-177228852 TAGCACTGGGGCCAGCATCTGGG - Intergenic
967116022 3:186339689-186339711 TCTCACAGGCCCCAGCGTACAGG - Intronic
969514448 4:7638630-7638652 GATGACGGGGTCCAGCATCCCGG - Intronic
971016578 4:22495340-22495362 GATCGCAGGGCCCAGGAGCCTGG + Intronic
976797502 4:88951022-88951044 TAACAGAGGACCCAGCAACCGGG - Intronic
980867077 4:138564391-138564413 TATCACAGGGCACAGTAACAGGG + Intergenic
982221422 4:153128633-153128655 GATCACAGTGCCCTGCAGCCTGG - Intergenic
987037079 5:14029788-14029810 TATCACAGGCTCCAGCATGGGGG - Intergenic
996227845 5:121023013-121023035 TAGCATATGGCCCACCATCCAGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1000853310 5:166367530-166367552 CATCCCTGGGCCCAGCACCCAGG - Intergenic
1003002856 6:2352074-2352096 TAAGTCAGGGCCCAGCATGCAGG + Intergenic
1004852244 6:19712172-19712194 AGACACAGGGCTCAGCATCCTGG - Intergenic
1005562691 6:27056874-27056896 TAACACAATGCCCAGCAACCTGG + Intergenic
1006079784 6:31558532-31558554 CATCACACGGCCCAGCTCCCAGG - Exonic
1006302503 6:33201049-33201071 TGTCCCAGGGCCCTACATCCGGG + Exonic
1013218295 6:108051728-108051750 TATCACAAGGCTCATAATCCAGG + Intronic
1016283912 6:142451353-142451375 CCTCATAGAGCCCAGCATCCAGG + Intergenic
1017269889 6:152492864-152492886 TTTTAAAGGGCCCAGCAGCCTGG - Intronic
1018399573 6:163409372-163409394 TAGCACAAGGACCTGCATCCTGG + Intergenic
1018576766 6:165267602-165267624 TCTCACAGCACCCAGCATCCTGG - Intergenic
1018798010 6:167202223-167202245 TCGCACAGGGCCCAGCACCGAGG - Intergenic
1018814704 6:167321948-167321970 TCGCACAGGGCCCAGCACCGAGG + Intergenic
1018914271 6:168123251-168123273 TATCACAGCGGACAGCACCCCGG + Intergenic
1019017801 6:168892410-168892432 CATCACACAGCTCAGCATCCAGG + Intergenic
1019017814 6:168892489-168892511 CATCACACAGCTCAGCATCCAGG + Intergenic
1019744865 7:2694004-2694026 CAGCACAGGGCCCAGCACCCAGG + Intronic
1023872933 7:44272411-44272433 CATCACAGGGCTCAGCCTCCCGG - Intronic
1023940536 7:44766156-44766178 TCTCACAGGTTCCAGCTTCCTGG + Exonic
1025156746 7:56613877-56613899 TATCACTGGAAGCAGCATCCAGG - Intergenic
1025157099 7:56616904-56616926 TATCTCAGGACCCAGCACTCAGG - Intergenic
1025160839 7:56659259-56659281 AATCAGTGGGCCAAGCATCCCGG + Intergenic
1025223876 7:57139895-57139917 TATCACTGGGTCCAGCTTCCAGG + Intergenic
1025277194 7:57593510-57593532 TATTACAGAGTCCAGCATCCAGG - Intergenic
1025722411 7:64028515-64028537 TATCACTGGGCCCAACAGCCAGG - Intergenic
1025722570 7:64029770-64029792 TATCACTGGGTCTAGCACCCAGG - Intergenic
1025745788 7:64241523-64241545 TATCACTGGCCCCAGCTTCTAGG - Intronic
1025750355 7:64288729-64288751 AATCAGTGGGCCAAGCATCCAGG - Intergenic
1025750542 7:64290297-64290319 TATCACTGAGCCTAGCACCCAGG - Intergenic
1025751142 7:64294824-64294846 TATCACTGGGCCCAGCAGCCAGG - Intergenic
1025759780 7:64379069-64379091 TATCACTGGGCCTAGTACCCAGG + Intergenic
1025759849 7:64379649-64379671 CATAACAGGGACCAGCAACCAGG + Intergenic
1025759901 7:64380199-64380221 AATCACTGGGACCAGCACCCAGG + Intergenic
1025759961 7:64380638-64380660 TATCACTGAAACCAGCATCCAGG + Intergenic
1025780804 7:64600273-64600295 TATCACTGGGCCCAGCACGCAGG + Intergenic
1025781036 7:64602062-64602084 TATCGCAGGGCCCAGCAACCAGG + Intergenic
1025781049 7:64602133-64602155 TATTGCTGGGCCCAGTATCCAGG + Intergenic
1025781386 7:64604843-64604865 TATCGCTGGGCTCAGCAACCAGG + Intergenic
1025781554 7:64606513-64606535 TATCACTGGACCCAGCACCTTGG + Intergenic
1025781691 7:64607659-64607681 TTTAACAGGGCCCAGCACACAGG + Intergenic
1025781896 7:64609251-64609273 TGTCACTGGGCTCAGCACCCAGG + Intergenic
1025781942 7:64609650-64609672 CATCACAGGACCCAGGACCCAGG + Intergenic
1025782181 7:64611607-64611629 TATTGCTGGGCCCAGCACCCAGG + Intergenic
1025782482 7:64614092-64614114 TATCACTGGGCCCAACAGCAAGG + Intergenic
1025782555 7:64614818-64614840 TATCACTGGACCCAGCACCAAGG + Intergenic
1025782876 7:64617454-64617476 TATGACTGGGCCCAGCACCTAGG + Intergenic
1025784852 7:64634985-64635007 TATCACTGGGCCCAGTACCCAGG + Intergenic
1025785400 7:64639243-64639265 TATCACCGGGCCTTGCACCCAGG + Intergenic
1025785433 7:64639514-64639536 TATCACTGTGCCCAGCACCAAGG + Intergenic
1025786894 7:64651986-64652008 TATCACTGGGCCCAGCATGCAGG + Intergenic
1025787851 7:64659761-64659783 TATCACAGAGCCCAGCACACAGG + Intergenic
1028716275 7:93973689-93973711 CATCACAGGGCCCAGAGGCCAGG - Intronic
1028828055 7:95297239-95297261 TTTCAGAGAACCCAGCATCCTGG + Intergenic
1029118121 7:98248409-98248431 GAGCACTGGGCCCAGCCTCCAGG - Intronic
1030190166 7:106802654-106802676 TATAACAGTGCCCAGCATAGAGG - Intergenic
1032614826 7:133456705-133456727 TATCACAGAGCCCAGGATGAAGG + Intronic
1034899775 7:154900512-154900534 CATCACAGGGCCCCCCAGCCCGG + Intergenic
1037815807 8:22111180-22111202 TAACACAGGGCCCTGCCTCCAGG - Intergenic
1040358538 8:46642909-46642931 TATCACAGGGCCTATCATGTAGG + Intergenic
1040371468 8:46780032-46780054 TATCTCAGGACCCAGCACCCAGG + Intergenic
1040375800 8:46823607-46823629 CATCACTGGATCCAGCATCCAGG + Intergenic
1040377484 8:46840484-46840506 TATCACTGGGACCATCATCCAGG + Intergenic
1040378406 8:46848880-46848902 TATCACTGGGACCATCAACCAGG + Intergenic
1040379059 8:46854649-46854671 TATCACTGAAACCAGCATCCAGG + Intergenic
1040379184 8:46855895-46855917 CATCACTGGATCCAGCATCCAGG + Intergenic
1040381354 8:46876392-46876414 TATCACAGGGCCTATCATGTAGG - Intergenic
1040383236 8:46893312-46893334 TATCACTGGGACCAGAATCCAGG - Intergenic
1044708338 8:95030519-95030541 AATGACAGGGCCCAGCATGGTGG - Intronic
1045295053 8:100865285-100865307 CATCACAGGGCCAAGCATGTGGG - Intergenic
1046107914 8:109689395-109689417 TATCACAGCTCCCTGCACCCTGG + Intronic
1047214211 8:122863674-122863696 CAGCACAGGGCCCAGAATCTAGG + Intronic
1047723758 8:127666876-127666898 TAGCACAGAGCCCAGCATGCAGG + Intergenic
1048170630 8:132102751-132102773 TGACACAGGGCCCACCATTCTGG - Intronic
1048934814 8:139346050-139346072 TATCCCAGGGCCCAGAACCTAGG + Intergenic
1049316984 8:141974586-141974608 TGTTGCAGGGCCCAGCATCGAGG + Intergenic
1049782606 8:144435738-144435760 TAACGCAGGGCCCAGCAGCCTGG - Exonic
1050259098 9:3822288-3822310 TATCCCAGGGAGCAGAATCCAGG + Intergenic
1053791806 9:41691808-41691830 TATGACTGAGCCCAGAATCCAGG - Intergenic
1054153346 9:61622960-61622982 TATGACTGAGCCCAGAATCCAGG + Intergenic
1054180210 9:61903823-61903845 TATGACTGAGCCCAGAATCCAGG - Intergenic
1054318405 9:63624582-63624604 TATGACTGGACCCATCATCCAGG + Intergenic
1054473145 9:65554165-65554187 TATGACTGAGCCCAGAATCCAGG + Intergenic
1054657382 9:67677319-67677341 TATGACTGAGCCCAGAATCCAGG + Intergenic
1056883672 9:90419563-90419585 TATCACGGGGCCCCTTATCCTGG + Intergenic
1058658748 9:107249341-107249363 TCACACAGGGCCCAGCTCCCAGG - Intergenic
1059738870 9:117130017-117130039 TATCACAGGGCCAGGCATGGTGG + Intronic
1060000466 9:119953674-119953696 TATCACAGGGGCTAGCATGCAGG + Intergenic
1060967394 9:127719411-127719433 TAGCACAGGGCTCAGCACCCAGG + Intronic
1203423651 Un_GL000195v1:18007-18029 TATCACAGGGCCCAGCACACAGG - Intergenic
1203424097 Un_GL000195v1:21839-21861 CATCACAGGGCCCAGAACACAGG - Intergenic
1203424138 Un_GL000195v1:22234-22256 TATCACTGGGCCCAGAACCCAGG - Intergenic
1203628256 Un_KI270750v1:46099-46121 TATTACAGAGTCCACCATCCAGG - Intergenic
1185718612 X:2363907-2363929 TATCTCTGTGCCCAGGATCCTGG - Intronic
1192523956 X:71825360-71825382 AAACACAGGGCCCAGCATGGTGG - Intergenic
1193656439 X:84203708-84203730 TATAACAGGGGCTTGCATCCAGG - Intergenic
1195851338 X:109285214-109285236 ATTCACAAGCCCCAGCATCCTGG + Intergenic
1197388160 X:125826618-125826640 TATCACAGCTCACAGCACCCAGG + Intergenic
1197547099 X:127838593-127838615 TATCACAGGCCCCAACACCCAGG - Intergenic
1200845248 Y:7825763-7825785 TATCACTGTGACCAGCACCCAGG - Intergenic
1200849525 Y:7868587-7868609 TATCACTGGGCCTAGTACCCAGG - Intergenic
1200854321 Y:7920860-7920882 TATCACTGGGACCATCACCCAGG - Intergenic
1200854666 Y:7924656-7924678 TATCACTGGGCCTAGCATATAGG - Intergenic
1200854899 Y:7926943-7926965 TATCACTGGGCCTAGTACCCAGG - Intergenic
1200856352 Y:7942765-7942787 TATCACTGAAACCAGCATCCGGG - Intergenic
1200856402 Y:7943201-7943223 TATCACTGGGACCATCACCCAGG - Intergenic
1200865176 Y:8035900-8035922 TATCACTGGGACCATCACCCAGG + Intergenic
1200866853 Y:8053012-8053034 TATCACTGGGCCTAGAACCCAGG + Intergenic
1200870109 Y:8088656-8088678 TATCACTGAAACCAGCATCCAGG - Intergenic
1200870734 Y:8095283-8095305 TATCACAGTACCCAGCACCCAGG - Intergenic
1200889758 Y:8311021-8311043 TATCTCAGGACCCAGCACCGAGG + Intergenic
1200891192 Y:8325932-8325954 TATTGCAGGGCCCAGCACCTAGG + Intergenic
1200891278 Y:8326885-8326907 TATCACTAGGACCATCATCCTGG + Intergenic
1200891430 Y:8328577-8328599 TATCACTGGAGCTAGCATCCAGG + Intergenic
1200895788 Y:8374797-8374819 TATCACAGGGCCCATCAGGCAGG - Intergenic
1200895882 Y:8375705-8375727 TATCTCTGGGCCCATAATCCAGG - Intergenic
1200896850 Y:8384900-8384922 TATCACCGGGACCATCACCCAGG - Intergenic
1200902293 Y:8444916-8444938 TATTGCAGGGCCCAGCACCCAGG - Intergenic
1200902788 Y:8449853-8449875 TATCACTGGGACCAGCATCCAGG + Intergenic
1202072272 Y:21004551-21004573 TATCACTGGACCCAGCACCTAGG - Intergenic
1202080331 Y:21077649-21077671 TATCACAGGATGCAGCATCCAGG + Intergenic
1202244826 Y:22809464-22809486 TATCACTGGGCCTAGTAACCAGG + Intergenic
1202244963 Y:22810755-22810777 TATCACGGGGACCAGCATCAAGG + Intergenic
1202245942 Y:22820325-22820347 TATCACTGGGACCACCACCCTGG + Intergenic
1202246103 Y:22822023-22822045 TATCACTGGATCTAGCATCCAGG + Intergenic
1202246517 Y:22825849-22825871 TATTTCAGGACCCAGCATCAAGG + Intergenic
1202246611 Y:22826788-22826810 TATAACAGGGCCCAGCAAAAGGG + Intergenic
1202247627 Y:22835953-22835975 TATCACAGGGCCTATCATGTAGG + Intergenic
1202251747 Y:22880203-22880225 TATCACTGAAACCAGCATCCAGG - Intergenic
1202252263 Y:22885460-22885482 TATCACTGGGACCAGCACCCAGG - Intergenic
1202254438 Y:22906437-22906459 TATCACTGGGACCAGCACCAAGG + Intergenic
1202259452 Y:22955173-22955195 TATGACAAAGCCCAGCACCCCGG + Intergenic
1202261319 Y:22973407-22973429 CATCACTGGATCCAGCATCCAGG + Intergenic
1202261941 Y:22979254-22979276 TATTGCAGGGTCCAGCACCCAGG + Intronic
1202262419 Y:22983662-22983684 TATCAAAGGGCCTATCATGCAGG + Intronic
1202262936 Y:22988680-22988702 TATCACTGGGACCATCACCCAGG + Intronic
1202264395 Y:23002855-23002877 TATCACTGGATCTAGCATCCAGG + Intronic
1202264944 Y:23008207-23008229 TATCTTAGGACCCAGCATCAAGG + Intergenic
1202267620 Y:23037394-23037416 TATCTCAGCACCCAGCACCCAGG + Intergenic
1202268508 Y:23045898-23045920 TATCACTGGGCCTAGTACCCTGG + Intergenic
1202270847 Y:23072742-23072764 TATCTCAGGACCCAACACCCGGG + Intergenic
1202295179 Y:23347940-23347962 TATCTCAGGACCCAACACCCGGG - Intergenic
1202397815 Y:24443210-24443232 TATCACTGGGCCTAGTAACCAGG + Intergenic
1202397953 Y:24444501-24444523 TATCACGGGGACCAGCATCAAGG + Intergenic
1202398930 Y:24454073-24454095 TATCACTGGGACCACCACCCTGG + Intergenic
1202399091 Y:24455771-24455793 TATCACTGGATCTAGCATCCAGG + Intergenic
1202399505 Y:24459597-24459619 TATTTCAGGACCCAGCATCAAGG + Intergenic
1202399600 Y:24460536-24460558 TATAACAGGGCCCAGCAAAAGGG + Intergenic
1202400615 Y:24469701-24469723 TATCACAGGGCCTATCATGTAGG + Intergenic
1202404735 Y:24513952-24513974 TATCACTGAAACCAGCATCCAGG - Intergenic
1202405252 Y:24519209-24519231 TATCACTGGGACCAGCACCCAGG - Intergenic
1202407429 Y:24540186-24540208 TATCACTGGGACCAGCACCAAGG + Intergenic
1202412438 Y:24588917-24588939 TATGACAAAGCCCAGCACCCCGG + Intergenic
1202414307 Y:24607148-24607170 CATCACTGGATCCAGCATCCAGG + Intergenic
1202414929 Y:24612995-24613017 TATTGCAGGGTCCAGCACCCAGG + Intronic
1202415409 Y:24617403-24617425 TATCAAAGGGCCTATCATGCAGG + Intronic
1202415926 Y:24622421-24622443 TATCACTGGGACCATCACCCAGG + Intronic
1202417386 Y:24636597-24636619 TATCACTGGATCTAGCATCCAGG + Intronic
1202417935 Y:24641949-24641971 TATCTTAGGACCCAGCATCAAGG + Intergenic
1202420612 Y:24671138-24671160 TATCTCAGCACCCAGCACCCAGG + Intergenic
1202421500 Y:24679642-24679664 TATCACTGGGCCTAGTACCCTGG + Intergenic
1202423842 Y:24706486-24706508 TATCTCAGGACCCAACACCCGGG + Intergenic
1202446947 Y:24963599-24963621 TATCTCAGGACCCAACACCCGGG - Intergenic
1202449286 Y:24990440-24990462 TATCACTGGGCCTAGTACCCTGG - Intergenic
1202450174 Y:24998944-24998966 TATCTCAGCACCCAGCACCCAGG - Intergenic
1202452851 Y:25028137-25028159 TATCTTAGGACCCAGCATCAAGG - Intergenic
1202453400 Y:25033489-25033511 TATCACTGGATCTAGCATCCAGG - Intronic
1202454861 Y:25047665-25047687 TATCACTGGGACCATCACCCAGG - Intronic
1202455378 Y:25052683-25052705 TATCAAAGGGCCTATCATGCAGG - Intronic
1202455856 Y:25057091-25057113 TATTGCAGGGTCCAGCACCCAGG - Intronic
1202456478 Y:25062938-25062960 CATCACTGGATCCAGCATCCAGG - Intergenic
1202458342 Y:25081153-25081175 TATGACAAAGCCCAGCACCCCGG - Intergenic
1202463353 Y:25129895-25129917 TATCACTGGGACCAGCACCAAGG - Intergenic
1202465528 Y:25150873-25150895 TATCACTGGGACCAGCACCCAGG + Intergenic
1202466044 Y:25156130-25156152 TATCACTGAAACCAGCATCCAGG + Intergenic
1202470165 Y:25200385-25200407 TATCACAGGGCCTATCATGTAGG - Intergenic
1202471180 Y:25209550-25209572 TATAACAGGGCCCAGCAAAAGGG - Intergenic
1202471275 Y:25210489-25210511 TATTTCAGGACCCAGCATCAAGG - Intergenic
1202471689 Y:25214315-25214337 TATCACTGGATCTAGCATCCAGG - Intergenic
1202471850 Y:25216013-25216035 TATCACTGGGACCACCACCCTGG - Intergenic
1202472828 Y:25225586-25225608 TATCACGGGGACCAGCATCAAGG - Intergenic
1202472966 Y:25226877-25226899 TATCACTGGGCCTAGTAACCAGG - Intergenic