ID: 1164257916

View in Genome Browser
Species Human (GRCh38)
Location 19:23545366-23545388
Sequence ATCCTGGACCTTTCTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 2, 3: 7, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164257916_1164257920 3 Left 1164257916 19:23545366-23545388 CCCTCTGTAGAAAGGTCCAGGAT 0: 1
1: 1
2: 2
3: 7
4: 120
Right 1164257920 19:23545392-23545414 GCATTACCTCACCTGGCTGATGG 0: 1
1: 0
2: 2
3: 12
4: 151
1164257916_1164257919 -4 Left 1164257916 19:23545366-23545388 CCCTCTGTAGAAAGGTCCAGGAT 0: 1
1: 1
2: 2
3: 7
4: 120
Right 1164257919 19:23545385-23545407 GGATGAAGCATTACCTCACCTGG 0: 1
1: 0
2: 16
3: 213
4: 1691
1164257916_1164257923 25 Left 1164257916 19:23545366-23545388 CCCTCTGTAGAAAGGTCCAGGAT 0: 1
1: 1
2: 2
3: 7
4: 120
Right 1164257923 19:23545414-23545436 GACTTAGCAATATGTCACAATGG 0: 1
1: 3
2: 14
3: 29
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164257916 Original CRISPR ATCCTGGACCTTTCTACAGA GGG (reversed) Intronic
902912983 1:19614810-19614832 ATCTTGGGCCATTCTGCAGAAGG - Intronic
904576073 1:31505808-31505830 ATCCTGCCCCTTTAGACAGATGG - Intergenic
904612366 1:31732604-31732626 ATCCTGGACCTGGGGACAGAGGG + Exonic
904895184 1:33811995-33812017 ATCATGGCCCTTTCCACACATGG - Intronic
904977898 1:34472591-34472613 ACCCTGAACATTTCTACAGGTGG - Intergenic
905786977 1:40766185-40766207 ATGCTGGATCTCTTTACAGATGG + Intronic
906768398 1:48458712-48458734 ATACTGGACATTTCTATAAATGG - Intronic
907049401 1:51319542-51319564 ATCCTAAACCTTTCTGGAGAAGG + Intronic
909050854 1:70766365-70766387 GTCCTGGACCCTTCTTCTGATGG + Intergenic
912932556 1:113978169-113978191 GTCATGGTCCTTTTTACAGAAGG + Intergenic
917236642 1:172899759-172899781 ATCATGAACTTTTTTACAGAAGG - Intergenic
920434078 1:205936903-205936925 CTCCTGGACCCTTCCACAAAAGG - Intronic
1066266801 10:33783757-33783779 ATCCTGAACCCATCTACAGCAGG - Intergenic
1070185302 10:74056743-74056765 ATCCTTGACCTTTCTCAAAATGG + Intronic
1071391814 10:85183036-85183058 ATCCTGGACCTAACTACTTATGG + Intergenic
1073204128 10:101759738-101759760 AGCCCTGACCTTTCTGCAGAAGG + Intergenic
1073378378 10:103057050-103057072 ATACTGAACCTTTCTATAGGGGG + Intronic
1073473496 10:103738445-103738467 ATTCTGGGCCTTTCTAATGAAGG + Intronic
1076417786 10:130303883-130303905 AACCTGGAACCTTCTCCAGATGG - Intergenic
1085219839 11:74864637-74864659 CTTCTGGACCTCTCTGCAGATGG - Intronic
1086530435 11:87778505-87778527 TTCCAGGACCTTTCAACAGTGGG + Intergenic
1087554634 11:99700739-99700761 GTCCTGGTCCTATCTACACAAGG + Intronic
1087769872 11:102196487-102196509 ATTCTGGACATTTCTAAAAATGG - Intronic
1087798662 11:102480827-102480849 ATACAGCACCTTTCTCCAGATGG + Intronic
1088606551 11:111539092-111539114 ACCCTGGACCTTGGTTCAGATGG - Intergenic
1091891151 12:4055576-4055598 CTCCTGGGCCTTTCTCCAGCTGG + Intergenic
1091950666 12:4590501-4590523 ATCCTGGGCCTTTCTAAAACTGG - Intronic
1093080603 12:14806378-14806400 ATCCTGAAGTTTTCTATAGAGGG + Exonic
1108984459 13:56567435-56567457 ATCCTGCCCCTTTCTGCACACGG + Intergenic
1109524556 13:63558056-63558078 TTCCTGGAGCTTTGTACAGAAGG + Intergenic
1111233716 13:85379980-85380002 ATCCAGGACTTTTCTACCTAAGG + Intergenic
1111342349 13:86903408-86903430 ATCCTCCACATTTCTAGAGATGG + Intergenic
1113063149 13:106346116-106346138 ATCATGGATATTTCTATAGAAGG - Intergenic
1115948307 14:38690343-38690365 ATCCTGGAGCTTTCTATGGCTGG - Intergenic
1119204675 14:72785166-72785188 ACCCTGGACATATTTACAGAAGG + Intronic
1119579013 14:75757478-75757500 ATCCTGCTCCTTTCTATAAATGG + Intronic
1120912540 14:89680652-89680674 ATCCAGCACCTTTTTTCAGATGG + Intergenic
1121434877 14:93912455-93912477 AGCCTCGATCTTTCTGCAGATGG + Intergenic
1121905097 14:97733054-97733076 ATCCTGGAGATTTCTGGAGATGG - Intergenic
1124212910 15:27777795-27777817 ATGCTGCACCTGTCTGCAGAGGG + Intronic
1125642025 15:41239029-41239051 TTCCAGTACCTTTCTACACATGG + Intronic
1127330388 15:57933134-57933156 CTTCTGGACCTATCTACAGATGG + Intergenic
1129428116 15:75479708-75479730 ATCCTGGCCTTTTATAAAGATGG - Intronic
1131700347 15:94928760-94928782 ATCCTGGATATTTCTGCAGTAGG + Intergenic
1141318455 16:82983851-82983873 CTCATGGACCTTTCAGCAGAGGG + Intronic
1143724610 17:8836666-8836688 ATTCTCCACCTTCCTACAGAAGG + Intronic
1144247227 17:13379032-13379054 ATCCTTGACCTTCCCACAGCTGG - Intergenic
1147779127 17:42927344-42927366 ATTCTGGACATTTCTATAAATGG - Intergenic
1148206187 17:45781696-45781718 ATATTGAACCTTTTTACAGAAGG + Intergenic
1149115844 17:53095418-53095440 ATTCTTGACCTTTCTACAAGGGG + Intergenic
1149163651 17:53724840-53724862 TTCCTGGACCTTTTGGCAGATGG - Intergenic
1153689948 18:7582318-7582340 ATCCTAGACCAGCCTACAGAAGG - Intronic
1155644965 18:28065965-28065987 ATCCTGGAGCTTTCTAGTGGAGG + Intronic
1162834667 19:13308379-13308401 TTCCTGGACATTTGTACAGGGGG - Intronic
1163400592 19:17089998-17090020 ATTCTGGACATTTCTATAAATGG + Intronic
1163838538 19:19591593-19591615 ATCCTGGGCCGTTCTTGAGAAGG - Intronic
1164079477 19:21850256-21850278 GCCCAGGCCCTTTCTACAGAGGG - Intronic
1164227886 19:23261875-23261897 ACCCTGGACCTGTCTACAGAGGG - Intergenic
1164257916 19:23545366-23545388 ATCCTGGACCTTTCTACAGAGGG - Intronic
1164282617 19:23782129-23782151 ATCCTGGACCTGTCTACAGAGGG + Intronic
1164294457 19:23897397-23897419 TGCCTGGGCCTTTCAACAGAGGG + Intergenic
1164313109 19:24063570-24063592 ATCCTGGACCGGTCTACAGAGGG + Intronic
1165605788 19:37102480-37102502 CTCCTGGACCTTTAGGCAGATGG + Intronic
1166593422 19:44023274-44023296 ATCCTGGGCTTTTCTACATTGGG - Intergenic
1167922638 19:52794550-52794572 ATCCTGGAATTTTCTAGAGAAGG - Intronic
925595139 2:5548120-5548142 AGCCTGGATCTTTCTCCACATGG + Intergenic
927585761 2:24303026-24303048 ATGCTGTACTTTTCTACAGCTGG - Intronic
932696035 2:73957322-73957344 ATTCTGAACCTTCCTACAGGGGG - Intronic
933688164 2:85159481-85159503 TTCCTGGTCCTTTCTGCAGAAGG - Intronic
934869511 2:97849791-97849813 AGCCTGGACCTTTTTTCATAAGG + Intronic
939377056 2:141382104-141382126 TTCCTGGACCTTTTGGCAGATGG - Intronic
942408754 2:175684457-175684479 AACCTGCACCTTACTTCAGAAGG - Intergenic
943504358 2:188734786-188734808 ATTCTGGACCTCTATACACATGG + Exonic
947512256 2:230766993-230767015 ATCCTTGAGCTTTCTTCATATGG - Intronic
948031810 2:234824124-234824146 AGCCTGGACATTGCTACGGAGGG - Intergenic
1172233846 20:33356096-33356118 ACCCTAGTCCTTTCTTCAGAAGG - Intergenic
1172881736 20:38204501-38204523 ATTCTGGACATTTCTATAAATGG + Intergenic
1173403201 20:42742807-42742829 CTTCTGTCCCTTTCTACAGATGG + Intronic
1174863464 20:54114081-54114103 ATCCTGAAGGATTCTACAGAGGG + Intergenic
1178177512 21:30119944-30119966 TTTCTGCACCTTTCTCCAGAGGG + Intergenic
1179975273 21:44861883-44861905 AGCATGGTCCTTGCTACAGATGG - Intronic
1182032759 22:27172845-27172867 ATCCTGGTTCTTTCTACTCAGGG + Intergenic
952577468 3:34792653-34792675 ATTCTGGAACCTGCTACAGAGGG - Intergenic
955167749 3:56531072-56531094 TTTCTGGGCCTTTCTCCAGAAGG - Intergenic
957036353 3:75296835-75296857 TTCCTGGTCCTTTCCAAAGAAGG + Intergenic
957389449 3:79544782-79544804 ATTCTGTACCTTAATACAGATGG - Intronic
959947582 3:112142892-112142914 ACCCTGGGGATTTCTACAGAGGG - Intronic
961306223 3:125960190-125960212 AGCCTGGCCCTGTCTAGAGAAGG - Intergenic
966220279 3:177544562-177544584 ATGCTAGGCCTTTCTTCAGATGG + Intergenic
969485825 4:7471965-7471987 GTCCTGGGCCTTTCTCCAGAGGG - Intronic
974157043 4:58086908-58086930 ATCATGGGCCTGTCTATAGACGG + Intergenic
978355658 4:107870008-107870030 ATCATGGACATTCCTACACAAGG - Intronic
980862010 4:138510244-138510266 ATCCTGGACCGTCCTAAAAATGG + Intergenic
982891684 4:160861255-160861277 ATTCTGGAATTTTCTACAAATGG + Intergenic
990367186 5:55082952-55082974 ACCCTAGACCCTTCTCCAGAGGG - Intergenic
990943272 5:61225645-61225667 TTCCTGGACCTATCCACAGCAGG + Intergenic
992339989 5:75813989-75814011 ATCCTGGACCTTCCCTCTGATGG - Intergenic
992639449 5:78756317-78756339 ATCTTGAACCTGTCTCCAGAAGG - Intronic
996245156 5:121254364-121254386 ATCCTGAACCTCTCCACAGAAGG - Intergenic
998022543 5:138782290-138782312 ATACTTCACCTTTCTTCAGAGGG + Intronic
998918042 5:147037638-147037660 ATTCTGTGCCATTCTACAGATGG - Intronic
1001833664 5:174811463-174811485 ATCCTGGCCTCTTCTACATAGGG - Intergenic
1002300484 5:178254850-178254872 ATCCTGCACTTTTTTACACAAGG - Intronic
1003126069 6:3356745-3356767 ATCCTGCACCTTATTACAGGTGG - Intronic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1008064341 6:47031543-47031565 ATCCTTGGACTTGCTACAGATGG + Intronic
1016829860 6:148423350-148423372 ATTCTGGAGCTTTTTAAAGATGG + Intronic
1017132789 6:151122391-151122413 ATCATGGACATCCCTACAGAAGG - Intergenic
1019838511 7:3414791-3414813 ATTCTGGACATTTTTACAAATGG + Intronic
1025157220 7:56618015-56618037 TGCCTGGCCCTTTCAACAGAAGG - Intergenic
1026051869 7:66953559-66953581 ATACTGTACCATTTTACAGAAGG - Intronic
1030973371 7:116089904-116089926 ACCCTGGGCCTTTGGACAGAAGG - Intronic
1033767525 7:144510463-144510485 ATCCTGGATCTGTCTCTAGAGGG - Intronic
1034280415 7:149850155-149850177 TTCCAGGACCCTTCTGCAGAGGG + Exonic
1035841323 8:2814339-2814361 ATCCTGAATGTTTCTGCAGAGGG + Intergenic
1037192735 8:16146893-16146915 TTCATGGAGCTATCTACAGACGG - Intronic
1038891769 8:31733618-31733640 AACCTGGACTTTTCTGGAGATGG - Intronic
1040316306 8:46262730-46262752 ATCCTGGAAGTTTCTCAAGAAGG + Intergenic
1040991820 8:53360062-53360084 ATTCTGGACATTTCAATAGATGG + Intergenic
1042738970 8:72021670-72021692 ACACTGGACTTTTCTAGAGATGG - Exonic
1046893374 8:119447379-119447401 ATCCTGGAATTTACTAAAGATGG + Intergenic
1050134925 9:2452580-2452602 ACCCTGGAGCTTTCTACAGGAGG - Intergenic
1050281544 9:4055568-4055590 TTGCAGGACCTTCCTACAGAAGG + Intronic
1052186249 9:25599184-25599206 ATACAGTACCTTTCTCCAGAGGG - Intergenic
1053297339 9:36924331-36924353 AACCTGGATCTTTCAACTGAAGG + Intronic
1057340530 9:94197622-94197644 GTCCTGGATCTTTCTGCTGATGG - Intergenic
1061566232 9:131442530-131442552 ACCCTGGACCTTTTTACTAAGGG + Intronic
1190886062 X:54531617-54531639 ATTCTGGACCCTTCTATGGAAGG - Intronic
1192488691 X:71553884-71553906 ATCCTGACCCTATCTTCAGAGGG + Intronic
1195007541 X:100701197-100701219 GTACTGGACCTGTCTAGAGATGG - Intronic
1200864009 Y:8023279-8023301 TGCCTGGTCCTTTCAACAGAAGG - Intergenic