ID: 1164264837

View in Genome Browser
Species Human (GRCh38)
Location 19:23605395-23605417
Sequence GAGCCATCACACCCAGTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164264829_1164264837 15 Left 1164264829 19:23605357-23605379 CCTGCCTCGGCCTCCCAAAGTGC No data
Right 1164264837 19:23605395-23605417 GAGCCATCACACCCAGTCTATGG No data
1164264831_1164264837 11 Left 1164264831 19:23605361-23605383 CCTCGGCCTCCCAAAGTGCTGGG No data
Right 1164264837 19:23605395-23605417 GAGCCATCACACCCAGTCTATGG No data
1164264827_1164264837 29 Left 1164264827 19:23605343-23605365 CCTCAGGTGATCTGCCTGCCTCG No data
Right 1164264837 19:23605395-23605417 GAGCCATCACACCCAGTCTATGG No data
1164264836_1164264837 1 Left 1164264836 19:23605371-23605393 CCAAAGTGCTGGGATTACAGGTG No data
Right 1164264837 19:23605395-23605417 GAGCCATCACACCCAGTCTATGG No data
1164264833_1164264837 5 Left 1164264833 19:23605367-23605389 CCTCCCAAAGTGCTGGGATTACA No data
Right 1164264837 19:23605395-23605417 GAGCCATCACACCCAGTCTATGG No data
1164264835_1164264837 2 Left 1164264835 19:23605370-23605392 CCCAAAGTGCTGGGATTACAGGT No data
Right 1164264837 19:23605395-23605417 GAGCCATCACACCCAGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164264837 Original CRISPR GAGCCATCACACCCAGTCTA TGG Intronic