ID: 1164269538

View in Genome Browser
Species Human (GRCh38)
Location 19:23659369-23659391
Sequence GACAAATTGTCTTGCTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164269538_1164269544 24 Left 1164269538 19:23659369-23659391 CCTGCACAGCAAGACAATTTGTC 0: 1
1: 1
2: 0
3: 20
4: 169
Right 1164269544 19:23659416-23659438 TATGAGATTGCCAGGCATCATGG 0: 1
1: 0
2: 1
3: 17
4: 159
1164269538_1164269542 16 Left 1164269538 19:23659369-23659391 CCTGCACAGCAAGACAATTTGTC 0: 1
1: 1
2: 0
3: 20
4: 169
Right 1164269542 19:23659408-23659430 AATGCCTTTATGAGATTGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164269538 Original CRISPR GACAAATTGTCTTGCTGTGC AGG (reversed) Intronic
903015597 1:20359657-20359679 GACTAATTGTCGTGGTGTGCCGG + Intergenic
907607289 1:55830622-55830644 GCCACTTCGTCTTGCTGTGCTGG - Intergenic
908133692 1:61104228-61104250 CACATAGTGTCTTGCTGTGCAGG + Intronic
909137251 1:71817019-71817041 GGCAAGTTGGCTTGCTGTGGAGG - Intronic
910070258 1:83205742-83205764 AAAAAATTGTCTTTCTGGGCCGG + Intergenic
910635721 1:89405404-89405426 GCCAAGTTGTCTTGCTCAGCGGG - Intergenic
910743811 1:90551247-90551269 AAGAAAATATCTTGCTGTGCAGG - Intergenic
911156109 1:94638407-94638429 CACAAATTAGCTTGGTGTGCTGG + Intergenic
912144788 1:106780219-106780241 GACTAATTGTCTTGCTGGTCTGG - Intergenic
912527007 1:110290996-110291018 GATAAATTGTCTTGCCAGGCTGG - Intergenic
912698229 1:111856989-111857011 GACACACTGTCTTTCTGTGTCGG + Intronic
912737407 1:112162158-112162180 CACAAAATGTGTTCCTGTGCTGG - Intergenic
913102326 1:115580162-115580184 GTCAAATTGTCTTTGTTTGCAGG - Intergenic
913708454 1:121453309-121453331 TACAGTTTCTCTTGCTGTGCAGG + Intergenic
915285856 1:154851615-154851637 GACAAAAGGTCATGGTGTGCAGG - Intronic
915639434 1:157212030-157212052 GTCAAATTGTCTTTGTTTGCAGG - Intergenic
916145580 1:161736081-161736103 GACACAGTGTCTTTCTGTGTTGG - Intergenic
918833833 1:189433875-189433897 GATAAATTGTCTAGCTGTTCCGG - Intergenic
918997325 1:191779484-191779506 TACTATTTGTCTTTCTGTGCTGG - Intergenic
919085681 1:192917865-192917887 GACAAATTGTCCTTCTGTCCTGG + Intergenic
920448049 1:206035071-206035093 GAGCAATTTTCATGCTGTGCAGG - Intergenic
920839681 1:209544277-209544299 GAACAATTGGCTTCCTGTGCTGG - Intergenic
1066341170 10:34535046-34535068 GACAAATTGTAGTCCTGAGCAGG + Intronic
1068433872 10:56966206-56966228 GATAATTTCTTTTGCTGTGCAGG - Intergenic
1069467236 10:68652139-68652161 GACAACTAGTCTTGCTTTGTGGG - Intronic
1072031126 10:91523597-91523619 GACAAGTTTTCTTGCTGTTTGGG - Intergenic
1079014882 11:16860198-16860220 GAGAAAGTGTCTTCCTGTTCAGG - Intronic
1079257246 11:18842045-18842067 GTCAAATTGTCTCTCTTTGCGGG + Intergenic
1079654297 11:22969199-22969221 GATAATTTATTTTGCTGTGCAGG + Intergenic
1080470405 11:32539727-32539749 GAGAAATTGACCTGCAGTGCTGG - Intergenic
1081689709 11:45069579-45069601 GGAAGCTTGTCTTGCTGTGCAGG + Intergenic
1081744666 11:45464463-45464485 GACAAAAGGTCTGGCTGGGCTGG + Intergenic
1083466724 11:62852023-62852045 GTCAATTTGTGTTGCTGTGTTGG - Intergenic
1086031053 11:82356147-82356169 GATAAAGTGTCTTGCCGTGTTGG - Intergenic
1088188741 11:107203999-107204021 GACAGATTTTCATGCTGTGAGGG + Intergenic
1089218694 11:116852520-116852542 GGCAAGTTATCTTGCTTTGCTGG + Intronic
1092109572 12:5949334-5949356 TACAAATTGCCTAGCTGTCCTGG - Intronic
1093305078 12:17506908-17506930 GAGAAATTGTCTTACTGTGAAGG - Intergenic
1099487430 12:83245885-83245907 GATAGTTTGTTTTGCTGTGCAGG + Intergenic
1099881916 12:88477393-88477415 GACAGTTTCTTTTGCTGTGCAGG - Intergenic
1102227500 12:111239400-111239422 GATAGATTGTGTTTCTGTGCTGG - Intronic
1103364562 12:120371868-120371890 GACAAATCCTCTTTCAGTGCAGG + Intergenic
1104502534 12:129300255-129300277 GGCAACTTGCCTTGCTTTGCAGG - Intronic
1105047807 12:133020705-133020727 GATATATTGTCTTACTGTTCTGG + Exonic
1105577257 13:21665527-21665549 GAGACAGAGTCTTGCTGTGCTGG + Intergenic
1106069162 13:26390379-26390401 AACAGATTGTAGTGCTGTGCTGG + Intronic
1107733029 13:43367641-43367663 AACATATTGTCTTGCAGTTCTGG - Intronic
1107790082 13:43993146-43993168 GATAGTTTGTTTTGCTGTGCAGG - Intergenic
1108070486 13:46624034-46624056 GAAAAATTGTCTGGGTGTGGTGG - Intronic
1108875888 13:55050288-55050310 GATAATTTCTTTTGCTGTGCAGG - Intergenic
1111274675 13:85933395-85933417 GATAGTTTGTTTTGCTGTGCAGG + Intergenic
1112053892 13:95671803-95671825 GGCAAGTCCTCTTGCTGTGCTGG - Intergenic
1115895557 14:38082720-38082742 GACAAATTGGATTGTTGTGAAGG + Intergenic
1116890037 14:50259170-50259192 GACATGTTGTCTTGCTAAGCTGG + Intronic
1117442718 14:55775054-55775076 AACTTATTGTCTTGCAGTGCTGG + Intergenic
1119140375 14:72262178-72262200 GACAATTTGTCATGCTGTGAGGG - Intronic
1127680422 15:61290752-61290774 CAAAATTTGTCTTTCTGTGCCGG - Intergenic
1129310961 15:74708691-74708713 GAGAGATGATCTTGCTGTGCAGG + Intergenic
1139157964 16:64467188-64467210 GACAGTTTGTTTTGCTGTGCAGG - Intergenic
1142256581 16:89016962-89016984 GACTATTTTTCCTGCTGTGCTGG - Intergenic
1144152132 17:12459012-12459034 GACAAACTGTCTTGGCCTGCGGG + Intergenic
1146451056 17:32974339-32974361 ATCAAATTGTCTTGTTTTGCAGG + Intronic
1150489722 17:65565913-65565935 GACAAATTGGCTGGGTGTGGTGG + Intronic
1154288794 18:13086319-13086341 GTCAAATTGTCTCTCTTTGCAGG - Intronic
1156021639 18:32606287-32606309 GGCAAATCCTCATGCTGTGCTGG - Intergenic
1157048411 18:44130842-44130864 GTCAAATTGTCTTGCCATGGTGG - Intergenic
1158801564 18:60916881-60916903 GACAATTTTTTTTGTTGTGCAGG - Intergenic
1160016989 18:75152047-75152069 GCCAAATTTTCAAGCTGTGCAGG - Intergenic
1161729663 19:5951571-5951593 GACAAGTTTTTTTGCTCTGCAGG + Exonic
1164044914 19:21528855-21528877 GACAAATTTTTATGATGTGCTGG - Intronic
1164093696 19:21985240-21985262 GACAAACTTTCTTGCTGTTGGGG - Intronic
1164103050 19:22075904-22075926 AACAAATTTTCTTGCTGTGGAGG + Intronic
1164141277 19:22466693-22466715 GACAAATTATCTTGCTGTGCAGG + Intronic
1164253174 19:23502837-23502859 GACAAATTTTCTTGCTTTCAGGG - Intergenic
1164269538 19:23659369-23659391 GACAAATTGTCTTGCTGTGCAGG - Intronic
1164285459 19:23811475-23811497 GACAAATTTTCTTGCTGTCAGGG + Intronic
1164297242 19:23922881-23922903 GACAAATTTTCTTGCTGTCAGGG + Intronic
926566822 2:14484913-14484935 GATAATTTCTTTTGCTGTGCAGG - Intergenic
927184085 2:20469741-20469763 GGCAAATTGAGTTGCTGTGCGGG + Intergenic
929712349 2:44278038-44278060 GATATATTTTGTTGCTGTGCTGG + Intronic
930046658 2:47178302-47178324 CAGAAATGGTCTTGCTGGGCAGG - Intergenic
933622865 2:84563660-84563682 GAAAATTTCTTTTGCTGTGCAGG + Intronic
934118529 2:88818199-88818221 GACAATTGGTCTTTCTGGGCAGG - Intergenic
934158823 2:89228757-89228779 GATAATTTGTTTTGCTCTGCAGG + Intergenic
934208451 2:89953671-89953693 GATAATTTGTTTTGCTCTGCAGG - Intergenic
934911308 2:98257200-98257222 AACTATTTGTCTTTCTGTGCCGG + Intronic
939551209 2:143618162-143618184 CTCAACTTTTCTTGCTGTGCTGG - Intronic
940599251 2:155836662-155836684 GAGAAAGTGTCTTGCTGTTTTGG - Intergenic
945147047 2:206749117-206749139 TCCAAATTGTCTTCCTGTGGTGG + Exonic
945343813 2:208688816-208688838 GTCAAATTGTCTTTGTTTGCAGG - Intronic
946543683 2:220713469-220713491 GACCACTTGTTTTGATGTGCAGG + Intergenic
946628390 2:221640008-221640030 GCGATATTGTCTTTCTGTGCTGG + Intergenic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1169653182 20:7892490-7892512 GACCAATTGTGTGGCTGTGATGG - Intronic
1170091503 20:12594081-12594103 TACAAATTGTATTCCTGTGTTGG - Intergenic
1173709666 20:45143551-45143573 GACAAATCCTAGTGCTGTGCTGG - Intergenic
1175632578 20:60554687-60554709 TCCAAATTGTTTTGCTTTGCAGG + Intergenic
1180585095 22:16881212-16881234 GACAAACTTTTTTCCTGTGCAGG + Intergenic
951253728 3:20424874-20424896 GACAAAATGTTTTGATTTGCAGG + Intergenic
951829042 3:26903538-26903560 GACAGTTTCTTTTGCTGTGCAGG - Intergenic
954250835 3:49366080-49366102 GACAAAATGTTTTGCTCTGGAGG + Intronic
956055280 3:65291954-65291976 AACAAGTTTTATTGCTGTGCAGG - Intergenic
956477493 3:69637994-69638016 GATAGTTTGTTTTGCTGTGCAGG + Intergenic
957264702 3:77948204-77948226 GAAAAGTGGTTTTGCTGTGCTGG - Intergenic
957613133 3:82494710-82494732 GAAAAATTGTCTTGATGTATTGG + Intergenic
961089300 3:124095894-124095916 GAGGAATAGTCTTGGTGTGCCGG + Intronic
963815906 3:149830834-149830856 GAAAAAATGGCTTGCTGGGCTGG + Intronic
963816680 3:149838660-149838682 GAAAAAATGGCTTGCTGGGCTGG - Intronic
965053077 3:163676563-163676585 GACTATTTATTTTGCTGTGCAGG - Intergenic
965832840 3:172814452-172814474 GCCAAATTGCCTTGTTATGCTGG - Intronic
966251062 3:177865897-177865919 GCCAAATGGTCTTGCTCAGCAGG + Intergenic
969004892 4:4011206-4011228 GAGAAATTGTCTTGTGGTTCTGG - Intergenic
970804194 4:20010907-20010929 GACAAGTAGTTTTTCTGTGCTGG + Intergenic
972837056 4:42884391-42884413 GTCAAATTGTCTCCCTCTGCAGG - Intergenic
974374085 4:61054394-61054416 GATTAATGGTCTTGCTTTGCTGG + Intergenic
975579886 4:75896836-75896858 GACAGATGGCCTTGCTGTTCTGG - Intronic
977999670 4:103541981-103542003 GACAAATTATCTTTGTTTGCAGG - Intergenic
978206633 4:106088127-106088149 GACAGTTTATTTTGCTGTGCAGG - Intronic
981492696 4:145357113-145357135 CAAAATTTGTCTTTCTGTGCTGG - Intergenic
983519893 4:168697291-168697313 GATTAATTCTCTTGCTGTGGTGG - Intronic
983599154 4:169504626-169504648 CAAAACTTGTCTTTCTGTGCCGG - Intronic
984348831 4:178565947-178565969 GACAAGTTGTCTTCTTGTGTTGG + Intergenic
984702777 4:182828813-182828835 GACAGATTGTCTTCCTCTGATGG + Intergenic
988896687 5:35682296-35682318 GACAGATTATCTTGCTGTAGTGG - Intronic
989959459 5:50393125-50393147 AACAAATTTTCTTGTTGTTCTGG - Intergenic
993270455 5:85789481-85789503 GACCAATTATCTTGCAGTGAGGG - Intergenic
993528622 5:88998546-88998568 GAGAAATTCTCCTGCTGTCCTGG + Intergenic
993697160 5:91075151-91075173 GATAATTTCTTTTGCTGTGCAGG + Intronic
994004602 5:94823015-94823037 GATAGATTCTTTTGCTGTGCAGG + Intronic
994274782 5:97822556-97822578 GACAACTTCTATTGCTGGGCTGG - Intergenic
996144698 5:119959666-119959688 GTCAAATTGTCTATCTTTGCAGG + Intergenic
996687164 5:126295644-126295666 GACAGTTTCTTTTGCTGTGCAGG - Intergenic
996711096 5:126544330-126544352 GACAGATTTTGTTCCTGTGCTGG - Exonic
998215506 5:140235699-140235721 GACAAAATGTTTTTCTGGGCTGG - Intronic
999501716 5:152153314-152153336 GACAAATGGACTTACTGTGAAGG + Intergenic
999641537 5:153678057-153678079 GCCAAATAATCTTGCTGTGCTGG - Intronic
1000923479 5:167165881-167165903 GGGAAATTGTCTTGATGTGATGG + Intergenic
1001133808 5:169085677-169085699 GACGATTTGTCTTGCTGAGCTGG - Intronic
1002850041 6:986008-986030 GATAGTTTCTCTTGCTGTGCAGG + Intergenic
1005342919 6:24859959-24859981 GAGAAATTGACTTGCTGTGATGG + Intronic
1005657346 6:27954369-27954391 GAAAAATTGTCTGGGTGTGGTGG - Intergenic
1006048308 6:31318569-31318591 AACAACTTCTCCTGCTGTGCTGG + Intronic
1011317098 6:86047024-86047046 CACTATTTGTCTTTCTGTGCTGG + Intergenic
1012980592 6:105826473-105826495 GTCAAATTGTCTCTCTTTGCAGG + Intergenic
1014029733 6:116686516-116686538 GACAGATTCTTTTGCTGTGCAGG + Intronic
1016583072 6:145651247-145651269 GACAAATTGTATGGCTTTGGTGG - Intronic
1018900638 6:168050152-168050174 GACAAAGTGTCTGCCTGTGCCGG + Intergenic
1019990366 7:4686180-4686202 TACAGATTCTCTTGCTGTGTTGG + Intronic
1022238762 7:28488754-28488776 GATAAATTGTCCTGCTGTGTTGG + Intronic
1022634019 7:32114642-32114664 GACAGTTTCTTTTGCTGTGCAGG - Intronic
1024238214 7:47414183-47414205 GTCAAACTGTGTTGCTCTGCAGG - Intronic
1025816812 7:64920924-64920946 GACAAATTTTCTTGTTGTGAGGG + Intronic
1026297914 7:69071819-69071841 GACTTATTGCCTTGCTGTGCAGG - Intergenic
1027697869 7:81433833-81433855 AACATATTGTCTTGCTGTTGGGG + Intergenic
1027779441 7:82503885-82503907 GACACATTTTTTTGCTCTGCCGG - Intergenic
1028759029 7:94474172-94474194 GAAAAATTTTCCTGCTCTGCAGG + Intergenic
1029285991 7:99466409-99466431 CAAAAATTAGCTTGCTGTGCTGG - Intergenic
1029641595 7:101823976-101823998 GAAAAATTGTCTTGCTTTTGGGG - Intronic
1030662659 7:112238499-112238521 GACAAATCCTTGTGCTGTGCTGG + Intronic
1032592350 7:133203709-133203731 GAGAAAGAGTCTTGCTGTGTTGG - Intergenic
1036282259 8:7410573-7410595 CACAAATTATCTTGCTGTTTTGG + Intergenic
1036288213 8:7463113-7463135 AATAAATTCTCTGGCTGTGCTGG - Intronic
1036333262 8:7848415-7848437 AATAAATTCTCTGGCTGTGCTGG + Intronic
1036339209 8:7900998-7901020 CACAAATTATCTTGCTGTTTTGG - Intergenic
1038378451 8:27067965-27067987 GTAAAATTGTCTTTCTTTGCAGG + Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1043011958 8:74892304-74892326 GAAAAATTGGCCTGCTGTGGTGG - Intergenic
1043080571 8:75760575-75760597 GAAAAATTGTTTTTCTGGGCAGG + Intergenic
1043143279 8:76618086-76618108 AACAAATTAGCTTGCTGTGGTGG + Intergenic
1043835983 8:85046602-85046624 GATAATTTATTTTGCTGTGCAGG + Intergenic
1046132028 8:109977156-109977178 GAGGAGTTTTCTTGCTGTGCAGG - Intergenic
1046335445 8:112780910-112780932 GACAAATCCTGGTGCTGTGCTGG + Intronic
1046480779 8:114814703-114814725 GTCAAATTATCTTCCTTTGCAGG + Intergenic
1047000867 8:120570963-120570985 AACAAAGTGTGTTGATGTGCAGG - Intronic
1047570890 8:126097676-126097698 GACAAATGGTGCAGCTGTGCGGG - Intergenic
1055798260 9:80000318-80000340 GACAAATTTTATTGCGTTGCTGG + Intergenic
1058485971 9:105443743-105443765 GAGACATGGTCTTGCTGTGTTGG - Intergenic
1058820805 9:108727925-108727947 GACAAATCATGGTGCTGTGCTGG + Intergenic
1061253509 9:129440210-129440232 CAAAAATTATCTGGCTGTGCTGG - Intergenic
1188716516 X:33465208-33465230 GCCCAGTTCTCTTGCTGTGCTGG - Intergenic
1188794524 X:34445313-34445335 GACAGTTTCTTTTGCTGTGCAGG - Intergenic
1191194192 X:57703941-57703963 GGCAAATATTATTGCTGTGCTGG - Intergenic
1191799935 X:65067091-65067113 GTCAAGTGGTCTTGCTGAGCAGG - Intergenic
1193364763 X:80619098-80619120 GTCAAATTGTCTTTGTTTGCAGG - Intergenic
1193556849 X:82964366-82964388 GATTATTTCTCTTGCTGTGCAGG + Intergenic
1194754670 X:97724213-97724235 GACAGTTTATTTTGCTGTGCTGG + Intergenic
1197601723 X:128539238-128539260 GTCAAATTGTCTTTGTTTGCAGG - Intergenic
1198076653 X:133199866-133199888 GACAGCTTCTTTTGCTGTGCAGG + Intergenic
1198317699 X:135485822-135485844 GAGAAAAAGTCTTGCTGTGTAGG + Intergenic
1200554665 Y:4621239-4621261 GATAATTTATTTTGCTGTGCAGG - Intergenic
1201667933 Y:16480133-16480155 GAAAAATTATCTGGATGTGCTGG + Intergenic