ID: 1164270797

View in Genome Browser
Species Human (GRCh38)
Location 19:23670002-23670024
Sequence GAAAACTTCTTGGCCCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164270797_1164270804 5 Left 1164270797 19:23670002-23670024 CCAGTCTGGGCCAAGAAGTTTTC 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1164270804 19:23670030-23670052 AGATGCCCCAGGAAAAATTTGGG 0: 1
1: 0
2: 4
3: 29
4: 232
1164270797_1164270803 4 Left 1164270797 19:23670002-23670024 CCAGTCTGGGCCAAGAAGTTTTC 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1164270803 19:23670029-23670051 GAGATGCCCCAGGAAAAATTTGG 0: 1
1: 0
2: 2
3: 23
4: 201
1164270797_1164270801 -6 Left 1164270797 19:23670002-23670024 CCAGTCTGGGCCAAGAAGTTTTC 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1164270801 19:23670019-23670041 GTTTTCCAGGGAGATGCCCCAGG 0: 1
1: 0
2: 3
3: 22
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164270797 Original CRISPR GAAAACTTCTTGGCCCAGAC TGG (reversed) Intronic
901423610 1:9167014-9167036 CAAAAATGCTTGGCCCAGGCCGG + Intergenic
906054475 1:42904327-42904349 GAAAACTTCTAGGCCTAAACAGG - Intergenic
908662984 1:66457243-66457265 TAAAACTTCTTGTCATAGACTGG - Intergenic
912892666 1:113551243-113551265 GTAAACTGCTTGGCCTAGAGAGG + Intronic
915436861 1:155913400-155913422 GAAAACTTCTTGACTAAAACTGG - Exonic
915627157 1:157121789-157121811 GAAAGTTTCTTGGCCCACAGAGG + Exonic
916227258 1:162500964-162500986 CAAAATTGCTTGGCCCAGGCTGG + Exonic
920213094 1:204342902-204342924 GAAAATCTCTTGACCCACACGGG - Intronic
922857962 1:228791156-228791178 GAAAAGTCCTTTGACCAGACAGG + Intergenic
923029758 1:230238951-230238973 AGAAAATTCTTGGTCCAGACTGG - Intronic
924711047 1:246530293-246530315 GAAAATTTCTTGAGCCTGACAGG + Intergenic
1063360517 10:5452388-5452410 GAAAACTTCTGGGCAGAGGCTGG - Exonic
1064475238 10:15681284-15681306 GTGAACTTCTTGGCCATGACGGG + Intronic
1064934536 10:20664996-20665018 GAAAAGTTCTCGGCCTGGACTGG - Intergenic
1065531672 10:26676387-26676409 AAAAACATCTTGGCCCAGTGTGG + Intergenic
1068102953 10:52579718-52579740 GAAGACTTCTTGGGCCAGGCCGG + Intergenic
1068129280 10:52877261-52877283 GTAAACTTCTGGGGCCAGGCAGG + Intergenic
1071712500 10:88063301-88063323 GAAAGCTTCTTCACCCAGAGGGG - Intergenic
1074404921 10:113172624-113172646 GAAAACTTCTGTGCACTGACAGG - Intergenic
1077528463 11:3083453-3083475 GAAAACCTCTTGGGCTAGGCCGG - Intergenic
1077626416 11:3775917-3775939 TAAAACTACTTGGCCCAAAGAGG + Exonic
1077961519 11:7081006-7081028 GAAATCTTTCTGGCCCAGAGCGG + Intergenic
1087128774 11:94651379-94651401 GAAAAATTCTGGGCCCAGCACGG - Intergenic
1089649346 11:119902192-119902214 GAAACCTGCCTGGCCCAGGCAGG - Intergenic
1094625843 12:32123436-32123458 GAAAACTTCTTTTCCCTGAAGGG - Intronic
1095132553 12:38561204-38561226 GAAAACACCCTGGCCCAGATTGG + Intergenic
1100269141 12:93007072-93007094 GAAGAATTCGTGGCACAGACAGG + Intergenic
1107571695 13:41666903-41666925 GAATCTTTCTTGGCCCAGAAAGG - Intronic
1109915075 13:68973659-68973681 GAAAACTTCATGAACCAGATAGG + Intergenic
1110223879 13:73099446-73099468 AAAAACTTCTTGGGGTAGACTGG + Intergenic
1111972994 13:94936534-94936556 GAAAACTTCTTTTCCCATGCTGG + Intergenic
1114734975 14:25034858-25034880 GAAAACTTCTTGGCCGGGTGTGG + Intronic
1117095771 14:52295943-52295965 GAAAATTACTTGTCCCAGCCGGG - Intergenic
1118242584 14:64074362-64074384 GAAGGCTGCTTGGTCCAGACTGG - Intronic
1118733313 14:68684496-68684518 GGAGTCTTCTTGGCCCAGAATGG - Intronic
1119409546 14:74421831-74421853 GAACACTTCTTGGCTCCCACGGG + Intronic
1119708329 14:76801864-76801886 GACAATTTCTTGGCCCAGCGCGG + Intronic
1121078675 14:91090177-91090199 GAAAACACCTTGTTCCAGACAGG + Intronic
1121613085 14:95294443-95294465 GGATGCCTCTTGGCCCAGACTGG - Intronic
1122422404 14:101585846-101585868 GAATAATTCTTGGCGCAGAGCGG - Intergenic
1123805195 15:23863577-23863599 AAAAAATTCTTGTCCCACACAGG - Intergenic
1123821043 15:24030838-24030860 GAAAAATGCTGGGCCCTGACTGG + Intergenic
1123999206 15:25740765-25740787 GAAAACTTCTGTGATCAGACGGG - Intronic
1131070676 15:89463799-89463821 GAAAAATTCTGGGCCCTGACTGG - Intergenic
1131441366 15:92462006-92462028 GGAAGTTTCTTGGCCCAGACAGG + Intronic
1132145214 15:99425453-99425475 GAGGCCTTCTAGGCCCAGACGGG - Intergenic
1133463691 16:6009385-6009407 CAGAAATTCTTGTCCCAGACTGG - Intergenic
1135585647 16:23668924-23668946 GAAAAGGTCATGACCCAGACTGG - Exonic
1138196681 16:55057431-55057453 GAAAACTTTTTTCCCCAGGCCGG - Intergenic
1141337105 16:83166354-83166376 GAGGACCTCTCGGCCCAGACAGG + Intronic
1141445082 16:84052448-84052470 GAAAACATCTCGGCCCACGCAGG - Intergenic
1141675568 16:85515586-85515608 GAAAACTGCCTGGCCCAGTCTGG - Intergenic
1142555889 17:777081-777103 GAGAACTTTTAGGACCAGACAGG - Intronic
1143392497 17:6568095-6568117 AGAAACATCTTGGCCCAGAAGGG + Intergenic
1143899514 17:10163414-10163436 AAAAATTTTTTGGCCCAGCCTGG - Intronic
1144306214 17:13971563-13971585 GAAAAATTCTAGGCCCTGACTGG - Intergenic
1145910426 17:28539038-28539060 GAAAACTTCTTGACCCACTGGGG + Intronic
1148769674 17:50059630-50059652 GAAAGCCTCTTGGCCTAGACTGG - Intronic
1151228135 17:72661761-72661783 GGAAACTTCTTGGTGCAGGCTGG + Intronic
1151512942 17:74572667-74572689 GCAAAGGTCTTGCCCCAGACAGG - Intergenic
1152228315 17:79102731-79102753 GCAAACTGCAGGGCCCAGACTGG + Intronic
1152550186 17:81025891-81025913 GAAAACTGCTTGGCTCTCACTGG + Intergenic
1153431070 18:5017867-5017889 AAAAAATTCTTGTCCCACACTGG + Intergenic
1157339152 18:46763940-46763962 ATAAACTTTGTGGCCCAGACAGG + Intergenic
1164270797 19:23670002-23670024 GAAAACTTCTTGGCCCAGACTGG - Intronic
1164835460 19:31352493-31352515 TAAAACTTTTTGGCCCCGCCTGG + Intergenic
1165498195 19:36166704-36166726 GAAAACTTGTTGGCCCGGCATGG - Intergenic
1165776932 19:38410175-38410197 GAACACTTCCCTGCCCAGACTGG + Intronic
1168579230 19:57539829-57539851 GAACAGTAATTGGCCCAGACAGG + Exonic
925576559 2:5366596-5366618 GAAAACACCAAGGCCCAGACAGG + Intergenic
927605386 2:24482285-24482307 GAATAATGCTTGGCCCATACTGG + Intergenic
929896922 2:45968808-45968830 GAAAACTTCAATGACCAGACTGG + Intronic
930584706 2:53255580-53255602 GAAAACATGAAGGCCCAGACAGG + Intergenic
931125591 2:59272881-59272903 GAAAGCTTCTGGGCCCATCCCGG + Intergenic
933558298 2:83859461-83859483 GTAAACTTCTTGGAGGAGACAGG - Intergenic
935616957 2:105095865-105095887 TCAAACTTCTGGACCCAGACTGG + Intronic
943272793 2:185828708-185828730 GAAATTTTCTTGGCTCACACTGG - Intronic
1168945432 20:1751528-1751550 GAGAACCTCTTGGCCCTTACAGG + Intergenic
1171020413 20:21579693-21579715 TAAAACCTCTAGGCCCATACTGG - Intergenic
1171259300 20:23717788-23717810 GAGAAGAACTTGGCCCAGACGGG - Intergenic
1171268394 20:23793361-23793383 GAGAAGAACTTGGCCCAGACGGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173378027 20:42507419-42507441 GAAGCCTTCTTGGCCGAGAAGGG + Intronic
1174468945 20:50741205-50741227 GAACACTTCGAGGCCAAGACGGG - Intronic
1178021350 21:28412026-28412048 GAAAAATACCTTGCCCAGACTGG + Intergenic
1178755425 21:35345073-35345095 GAAAACTTCTGGCCCCTCACTGG + Intronic
1178764517 21:35437211-35437233 GAACATTTCTTGCCCCAGGCTGG + Intronic
1180676825 22:17592238-17592260 GAAAACTTCTAGGCCTAAACAGG + Exonic
1180747849 22:18103754-18103776 GGAGGCTTCTTGGCCCAGCCCGG + Exonic
1183254519 22:36753771-36753793 AAAAACTTCCTGGCCCAAGCTGG - Intergenic
949724194 3:7024522-7024544 GAAAATTTCTGGGCACAGAGAGG + Intronic
951054379 3:18130118-18130140 GAACACTTCTCGGAGCAGACAGG + Intronic
955272706 3:57517754-57517776 GAAAACTCCCTGGCCCAGCACGG + Intronic
960917070 3:122706545-122706567 GAAAACTTCCTGTCCCAAGCAGG - Intronic
962068758 3:132011293-132011315 GACAACCTCTTTGCACAGACAGG + Intronic
962386252 3:134934939-134934961 TAACCCTTGTTGGCCCAGACAGG + Intronic
963719966 3:148851041-148851063 GAAAATTTCATGGCCAAGCCTGG + Intronic
964871458 3:161318002-161318024 GAGAACTTCATGCCCCAGATAGG + Intergenic
965536712 3:169831007-169831029 GAAAAAGTATTGGCCCAGAGTGG + Intronic
965641380 3:170832131-170832153 GAAGACAGCTTGGCCCAGGCTGG - Intronic
969189984 4:5510242-5510264 CAAAACTTATTTGCCAAGACCGG - Intergenic
969993504 4:11288702-11288724 GCAAAATGCTTGGCCCAAACAGG - Intergenic
984193065 4:176627281-176627303 GAACACTTCATTGCCCAGATAGG - Intergenic
987109882 5:14675801-14675823 GAAAACTTTTTGCCTCAGCCTGG - Intronic
990028233 5:51222512-51222534 GAATACTTCTGGGGCCAGGCAGG + Intergenic
992825997 5:80550753-80550775 AAACACTCCTTGCCCCAGACGGG - Intergenic
994823775 5:104686200-104686222 TAAAACTTCTTGCGCCAAACTGG - Intergenic
995297318 5:110537046-110537068 GAAAAATTCTAGGTCCTGACTGG - Intronic
996107287 5:119518936-119518958 GACAAGTTCTTGCCCCAGGCTGG - Intronic
999237701 5:150109006-150109028 GAAACTTTCATGGCCCAGAGCGG + Intronic
999398947 5:151249738-151249760 GAAAAATTCTGGGCCCAGACTGG + Intronic
1001434552 5:171689004-171689026 GAAGACTTCATGGCCCAGATGGG + Intergenic
1003321327 6:5054618-5054640 GAATCCTTCTTGGCCAAGAGAGG - Intergenic
1004774488 6:18827635-18827657 GAAATCCTCTTAGCCTAGACGGG + Intergenic
1015155287 6:130088023-130088045 GAGAAATTTTTGGCCCAGAGAGG + Intronic
1015694089 6:135960136-135960158 GATAACTTCTTCTCCCAGACTGG + Intronic
1015706220 6:136090728-136090750 GAAAACTTCTTGGCCCTCCTAGG - Intronic
1019207589 6:170375799-170375821 GACATCTTCTATGCCCAGACGGG - Intronic
1019403053 7:867358-867380 GAAAACCTGTTGGCCCTGCCAGG - Intronic
1022990038 7:35697626-35697648 GAAAACTTCCTGGCTTAAACAGG - Intergenic
1035300053 7:157891275-157891297 GCAAACCTCTTTGCACAGACAGG + Intronic
1035379739 7:158430199-158430221 GAAAACTTCATGTCCCAGCTGGG - Intronic
1035740365 8:1923616-1923638 GAAACCTTCTTGGCCAATGCTGG + Intronic
1036212939 8:6857138-6857160 GAAAAATTCTTTCCTCAGACAGG - Intergenic
1037254856 8:16941991-16942013 GAACACGTCCTGGCCCAGACGGG + Intergenic
1037579716 8:20237162-20237184 GGAAACTTCTTCCCTCAGACAGG + Intergenic
1037579722 8:20237194-20237216 GGAAACTTCTTCCCTCAGACAGG + Intergenic
1038750001 8:30286125-30286147 GACAACTTCTTGGCCAAGATGGG - Intergenic
1039221162 8:35332693-35332715 CCAAATTTCTTGGCCCAGAAAGG - Intronic
1040821524 8:51563616-51563638 GAAAACATCTTGGCCCAATTTGG - Intronic
1042062567 8:64836978-64837000 GAAAACTTCCTGGCTGAGAGAGG + Intergenic
1042473084 8:69213611-69213633 GAAAACTACTTAACCAAGACAGG + Intergenic
1043574843 8:81645445-81645467 AGAAACTCCTTGGCCCAGCCTGG + Intergenic
1044013260 8:87020481-87020503 GAAAGCTTTTTGGCCAAGAGTGG + Intronic
1045526904 8:102948742-102948764 GAAGACACTTTGGCCCAGACAGG + Intronic
1045832736 8:106483548-106483570 GGAAACTTCTTGGTGCAGATGGG - Intronic
1051763137 9:20490920-20490942 GAAAACTAATTGGCCCATAATGG + Intronic
1051805748 9:20990795-20990817 GAAAACTTCCTGACCCACCCAGG - Intronic
1187282591 X:17869771-17869793 TCAAATTTTTTGGCCCAGACTGG - Intergenic
1187651045 X:21406659-21406681 GAATACTTTTTGGCCCAGCTAGG - Intronic
1190725897 X:53190390-53190412 GAGAACTGCTTGGCCCAGGACGG - Intergenic
1193917407 X:87382071-87382093 GAAAAGTTGTTGGCCCAGTTCGG - Intergenic
1197311974 X:124916240-124916262 GAAATATGATTGGCCCAGACTGG - Intronic
1197793962 X:130281444-130281466 GAAAAATTCTGGGCCCAGGCTGG - Intergenic