ID: 1164272183

View in Genome Browser
Species Human (GRCh38)
Location 19:23682959-23682981
Sequence CCAGCAGGTCACCTGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24443
Summary {0: 1, 1: 7, 2: 184, 3: 2376, 4: 21875}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164272175_1164272183 8 Left 1164272175 19:23682928-23682950 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1164272183 19:23682959-23682981 CCAGCAGGTCACCTGAAGTCAGG 0: 1
1: 7
2: 184
3: 2376
4: 21875
1164272179_1164272183 -1 Left 1164272179 19:23682937-23682959 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 1164272183 19:23682959-23682981 CCAGCAGGTCACCTGAAGTCAGG 0: 1
1: 7
2: 184
3: 2376
4: 21875
1164272177_1164272183 0 Left 1164272177 19:23682936-23682958 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1164272183 19:23682959-23682981 CCAGCAGGTCACCTGAAGTCAGG 0: 1
1: 7
2: 184
3: 2376
4: 21875
1164272172_1164272183 27 Left 1164272172 19:23682909-23682931 CCGGGCACGGTGGCTCACACCTG 0: 5442
1: 34090
2: 96783
3: 140914
4: 159590
Right 1164272183 19:23682959-23682981 CCAGCAGGTCACCTGAAGTCAGG 0: 1
1: 7
2: 184
3: 2376
4: 21875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164272183 Original CRISPR CCAGCAGGTCACCTGAAGTC AGG Intronic
Too many off-targets to display for this crispr