ID: 1164275788

View in Genome Browser
Species Human (GRCh38)
Location 19:23716672-23716694
Sequence CACGCCCAGTTAATTTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164275788_1164275796 20 Left 1164275788 19:23716672-23716694 CCACAAAAAATTAACTGGGCGTG No data
Right 1164275796 19:23716715-23716737 GCTACTCGGGAGGCTGAGGCAGG 0: 87862
1: 235715
2: 200111
3: 128617
4: 141401
1164275788_1164275792 10 Left 1164275788 19:23716672-23716694 CCACAAAAAATTAACTGGGCGTG No data
Right 1164275792 19:23716705-23716727 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
1164275788_1164275790 6 Left 1164275788 19:23716672-23716694 CCACAAAAAATTAACTGGGCGTG No data
Right 1164275790 19:23716701-23716723 CATCTGTAATCCCAGCTACTCGG 0: 1968
1: 32278
2: 83985
3: 175623
4: 233398
1164275788_1164275791 7 Left 1164275788 19:23716672-23716694 CCACAAAAAATTAACTGGGCGTG No data
Right 1164275791 19:23716702-23716724 ATCTGTAATCCCAGCTACTCGGG 0: 2101
1: 38336
2: 160760
3: 257844
4: 211149
1164275788_1164275794 16 Left 1164275788 19:23716672-23716694 CCACAAAAAATTAACTGGGCGTG No data
Right 1164275794 19:23716711-23716733 CCCAGCTACTCGGGAGGCTGAGG 0: 97626
1: 275854
2: 227041
3: 130261
4: 162635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164275788 Original CRISPR CACGCCCAGTTAATTTTTTG TGG (reversed) Intergenic
No off target data available for this crispr