ID: 1164278224

View in Genome Browser
Species Human (GRCh38)
Location 19:23743131-23743153
Sequence CCCTGCAAATGTAATAAATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 2, 1: 7, 2: 13, 3: 62, 4: 464}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164278224 Original CRISPR CCCTGCAAATGTAATAAATT TGG (reversed) Exonic
904667774 1:32136794-32136816 CACTCCAAATGTAATGAATTGGG - Intronic
905754327 1:40495790-40495812 CCCTACAAATGTAAAGAATGTGG + Exonic
907552798 1:55318626-55318648 CCTTGCAACTGTGAGAAATTGGG - Intergenic
909087190 1:71181821-71181843 CACTGCAAATGGGATAAAATGGG - Intergenic
909652479 1:77991195-77991217 CCCTTCAAAGGTATTAACTTTGG + Intronic
910968784 1:92833105-92833127 CCTGTTAAATGTAATAAATTGGG + Intronic
912089782 1:106056842-106056864 CCTTTCAAATTTAATTAATTTGG - Intergenic
912242978 1:107930535-107930557 CCCTGAAAGTGTAATACATATGG - Intronic
912932623 1:113978835-113978857 CCCTGTAAATTCAATATATTTGG + Intergenic
915935471 1:160087923-160087945 CCCTGGAAATGTGCTAAAGTTGG + Exonic
917383860 1:174446762-174446784 AACTGCAAATGTAATAAACAAGG + Intronic
920654986 1:207868415-207868437 CCCTGCCAAATTAATAAAGTGGG - Intergenic
920841651 1:209560520-209560542 CTCTGCCAATGTTATAAAGTGGG + Intergenic
922687548 1:227655544-227655566 CCCTACAAATGTAAAGAATGTGG + Exonic
923923303 1:238594095-238594117 CAATGCAAATGTAATATACTAGG + Intergenic
924761100 1:246987190-246987212 CCCTACAAATGTGATGAATGTGG - Exonic
924764246 1:247016979-247017001 CCCTACAAATGTAATAATTTTGG + Intergenic
924764258 1:247017144-247017166 CTCTACAAATGTAATAAATGTGG + Intergenic
924785207 1:247189949-247189971 TCCTACAAATGTAAAAAATGTGG - Intergenic
924785230 1:247190285-247190307 CCCTACAAATGTGATGAATGTGG - Intergenic
1063235742 10:4114000-4114022 CCCCACAAATGTAATAATATAGG + Intergenic
1065691493 10:28338559-28338581 TCCTGCAAATGTAAGTAATTTGG - Intergenic
1065691592 10:28339587-28339609 CCCTACGAATGTAATACATGGGG - Intergenic
1066676834 10:37896900-37896922 CCCTGTGAATGTAAAGAATTTGG + Intergenic
1066682900 10:37952455-37952477 CCCTTTGAATGTAATAAATGTGG - Exonic
1066693430 10:38056114-38056136 CCCTATAAATGTAATGAATGTGG + Exonic
1066973088 10:42335151-42335173 CCGTACAAATGTAATAAGTGTGG - Intergenic
1066973198 10:42336930-42336952 CCCTGCAAATGTGAAGAATGTGG - Intergenic
1066973242 10:42337513-42337535 CCCTACAAATGTGATGAATGTGG - Intergenic
1067126815 10:43524702-43524724 CCCTGTGAATGTAATGAATGTGG + Intergenic
1067136851 10:43616764-43616786 CCCTACAAATGTAATGACTGTGG + Exonic
1067149926 10:43722901-43722923 CCATGAAAATATTATAAATTTGG + Intergenic
1068363385 10:56011508-56011530 CTCTGCAAGTGTATTAAAATTGG - Intergenic
1069635295 10:69921365-69921387 CATTGCAAATGTAATGAGTTAGG - Intronic
1071050973 10:81449063-81449085 CTCAGCAAATGAACTAAATTAGG - Intergenic
1072886316 10:99278122-99278144 AACTGCAAACTTAATAAATTAGG + Intergenic
1073963512 10:108961429-108961451 CCCTGTAAATGTAATAAATAGGG - Intergenic
1074223339 10:111459893-111459915 CCTTGGAAAAGTAATATATTAGG + Intergenic
1075999519 10:126904370-126904392 CCCTTTAAATGGAATAAATTTGG - Intergenic
1076658077 10:132037391-132037413 GTCTGCAAATGTAAGAAATGGGG + Intergenic
1080145103 11:28972723-28972745 TACTGGAAATGTAATAAAATAGG - Intergenic
1082252039 11:49993100-49993122 CCCACCAAATGAAATAAATAAGG + Intergenic
1086502302 11:87465881-87465903 GCCTGGAAATGTAATATGTTAGG + Intergenic
1088081458 11:105921046-105921068 CTCTGCAAAATTATTAAATTTGG + Intronic
1088561463 11:111120210-111120232 GACTCCAAATGTAATAAAGTGGG + Intergenic
1090705458 11:129332275-129332297 CTATGCAAATAAAATAAATTTGG - Intergenic
1090961677 11:131562844-131562866 CCTTGCAAATGAAAATAATTTGG + Intronic
1092767116 12:11862708-11862730 CCTTGCAGATGTAATTAGTTAGG - Intronic
1095200092 12:39373863-39373885 CCATGCAAATGGATGAAATTGGG - Intronic
1095372046 12:41479784-41479806 CCCAGAAAATGTAAGAAATGTGG + Intronic
1096357515 12:50953807-50953829 CCCTGCAAAATGAAAAAATTCGG + Intergenic
1097296440 12:57968630-57968652 CCCGGCAAATGTAATAAATTTGG + Intergenic
1099404241 12:82240631-82240653 ACGTGGAAAGGTAATAAATTGGG - Intronic
1099600440 12:84729091-84729113 CCTTTCAAAATTAATAAATTTGG + Intergenic
1099749157 12:86749494-86749516 CCCTCAAAATATTATAAATTAGG + Intronic
1099845180 12:88019653-88019675 CTCTGCACATGTAAGAGATTGGG + Intronic
1103885132 12:124194791-124194813 CCCTGGGAAGATAATAAATTGGG - Intronic
1105224670 13:18419822-18419844 CTCTAAGAATGTAATAAATTTGG + Intronic
1105228736 13:18467218-18467240 CCATACAAATGTAATAAATGTGG - Intergenic
1105228837 13:18468902-18468924 CCCTGCAAATGTGAAGAATGTGG - Intergenic
1105326494 13:19374925-19374947 TCCTGCAAATGTAATCCATGTGG + Intergenic
1106436069 13:29723869-29723891 CCCTGCAAATGGCTTAAATTAGG - Intergenic
1107404636 13:40101131-40101153 ACAGGCAAATGTCATAAATTGGG - Intergenic
1108192225 13:47953480-47953502 CCTTGCAAAATTAATAAATATGG + Intronic
1108402183 13:50057109-50057131 TCCTGTAAATGTTATATATTTGG - Intergenic
1110763868 13:79260438-79260460 CTCTTCAAATGGAATAAAATAGG - Intergenic
1111841701 13:93457319-93457341 CACTCCAAATGTAATTAGTTGGG - Intronic
1111903030 13:94223003-94223025 CCCTTAAAATGAAGTAAATTTGG + Intronic
1112719184 13:102223392-102223414 CACTGAAAATGGAATTAATTGGG - Intronic
1112990942 13:105513504-105513526 ACCTGCAAATGAAACAAATGTGG + Intergenic
1114013015 14:18394082-18394104 CCATACAAATGTAATAAATGTGG - Intergenic
1114708545 14:24753034-24753056 TCCTTCAAAGGTAATAAATGAGG - Intergenic
1116911579 14:50471817-50471839 CCCTATAAATGTAAGAAATGTGG + Intronic
1117873471 14:60224725-60224747 CTTTGCAAATGTAATTAGTTAGG + Intergenic
1118119721 14:62826310-62826332 CCAGGCAAATGAAATAAATAAGG - Intronic
1119190062 14:72675245-72675267 CCCTGGAAATGGAATGATTTTGG - Intronic
1120083650 14:80244041-80244063 TCCTAGAAATGTAATATATTTGG - Intronic
1121580877 14:95028907-95028929 CCCTGCAAGTTTACTGAATTTGG + Intergenic
1122308047 14:100777757-100777779 CCCTGGAGATGCAATCAATTAGG + Intergenic
1202888687 14_KI270722v1_random:134318-134340 CCCTACAAATGTATTGAATGTGG + Intergenic
1202940572 14_KI270725v1_random:141840-141862 CTCTACAAATGTAATTCATTTGG - Intergenic
1124210130 15:27756206-27756228 CCCTGCAAATGTTACAATTTTGG + Intronic
1126254251 15:46606521-46606543 CCATACAAATGTAATAAATCCGG + Intergenic
1126749599 15:51863445-51863467 GTCTGGAAATGTAATCAATTCGG - Intronic
1127929112 15:63578832-63578854 GCCTGCAAATGTTAATAATTTGG - Intronic
1130332194 15:82931147-82931169 CCCTGGAAATGTCATAAAAGAGG - Intronic
1130609295 15:85346336-85346358 TCCTGCAATTGTAATTAATTGGG - Intergenic
1131713195 15:95078646-95078668 CCATGCCAATGTTAAAAATTAGG + Intergenic
1132898838 16:2242580-2242602 CTCTGCAGATGTAATTAAGTTGG + Intronic
1136644667 16:31601644-31601666 CCCTACAAATGTAAAGAATGTGG - Intergenic
1136660503 16:31755630-31755652 CCCTACAAATGTAAAGAATGTGG + Intronic
1136676756 16:31916308-31916330 CCCTACAAATGTGATGAATGTGG + Exonic
1138179400 16:54931741-54931763 CCCTGCAAATTTTATATTTTTGG + Intronic
1138321362 16:56115735-56115757 ACTTGCAAATGAGATAAATTAGG + Intergenic
1138757177 16:59502567-59502589 CCTTGCTAATGTAATATACTTGG - Intergenic
1139043666 16:63031025-63031047 CCCTGCTAATATATTAATTTTGG - Intergenic
1143199991 17:5106065-5106087 CCCTTCGAATGTAATGAATGTGG - Exonic
1144594118 17:16552097-16552119 CCCTATAAATGTAATGAATGTGG - Exonic
1144601795 17:16622361-16622383 CCCTATAAATGTAATGAATGTGG - Exonic
1144601877 17:16623285-16623307 CCCTATAAATGTAATGAATGTGG - Exonic
1144601924 17:16623873-16623895 CCCTATAAATGTAATGAATGTGG - Exonic
1151857420 17:76731665-76731687 TTCTGCAAATGTGATAAAATTGG - Intronic
1153313655 18:3701510-3701532 CCATGCTTATGTGATAAATTTGG + Intronic
1154314132 18:13290610-13290632 TCTTGCACATGTAAAAAATTAGG + Intronic
1154524628 18:15271391-15271413 CCCTGCAAATGTGAAGAATGTGG + Intergenic
1154524727 18:15273080-15273102 CCATACAAATGTAATAAATGTGG + Intergenic
1154528686 18:15319628-15319650 CTCTAAGAATGTAATAAATTTGG - Intergenic
1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG + Exonic
1156871544 18:41951626-41951648 CCAAGCAAAGGGAATAAATTGGG + Intergenic
1157504463 18:48216880-48216902 CACTGCAGATGTAATTAATTAGG + Intronic
1158744230 18:60179313-60179335 CCCTGCAAAAGTTTAAAATTTGG - Intergenic
1159135272 18:64330108-64330130 CTTTGCACATGTAATTAATTAGG - Intergenic
1159335861 18:67065001-67065023 AACTGCAAAAGTAATAATTTCGG - Intergenic
1159617615 18:70599202-70599224 CACTCCAAATGTGAGAAATTGGG - Intergenic
1162247490 19:9414272-9414294 CCCTACAAATGTAAGGAATGTGG - Exonic
1162260429 19:9529188-9529210 CCCTACAAATGTAAGGAATGTGG - Exonic
1162270499 19:9611053-9611075 CCCTACAAATGTAAGGAATGTGG - Exonic
1162275783 19:9653601-9653623 CCCTACAAATGTAAGGAATGTGG - Exonic
1162603128 19:11685335-11685357 CCCTATGAATGTAATAAATGTGG + Intergenic
1162607619 19:11722902-11722924 TCGTGCAAATGAAATAAACTGGG + Exonic
1162629097 19:11912192-11912214 CCCTGTGAATGTAAGAAATGTGG + Intronic
1162669888 19:12247674-12247696 CCCTACAAATGTAAGGAATGTGG - Intronic
1162669925 19:12248178-12248200 CCCTACAAATGTAAGGAATGTGG - Intronic
1162672934 19:12273395-12273417 CCCTACAAATGTAAACAATGTGG - Exonic
1162686666 19:12391751-12391773 TCATGCATATGTAATAAACTGGG + Exonic
1162691017 19:12431525-12431547 TCATGCATATGTAATAAACTGGG + Exonic
1162694718 19:12464981-12465003 CCCTATAAATGTAAAAAATGTGG - Exonic
1162702425 19:12527080-12527102 CCCTATGAATGTAATAAATGTGG - Exonic
1162715429 19:12628676-12628698 CCCTACGAATGTAAAAAATGTGG + Exonic
1163857115 19:19712427-19712449 CCCTACAAATGTAAAGAATGTGG - Exonic
1163868221 19:19793413-19793435 TCCTGCAAATATAATGAATTTGG - Intronic
1163872632 19:19835588-19835610 CCCTACAAATGTAAAGAATGTGG + Intergenic
1163878056 19:19892430-19892452 CCCTACAAATGTGATGAATGTGG + Exonic
1163882099 19:19933973-19933995 CCATACAAGTGTAATAAATGTGG + Exonic
1163890322 19:20006546-20006568 CCCTACAAATGTAAAGAATGTGG - Exonic
1163902620 19:20118404-20118426 CCCTACAAGTGTGATAAATGTGG + Exonic
1163902641 19:20118656-20118678 CCCTACAAGTGTGATAAATGTGG + Exonic
1163902782 19:20120488-20120510 TCCTGCAAATGTAGTGAATTTGG + Intronic
1163911586 19:20199400-20199422 TCCTGCAAATGTAATGAGTTTGG + Exonic
1163931527 19:20397978-20398000 CCCTACAAATGTAAAGAATGTGG - Intergenic
1163931556 19:20398314-20398336 CCATGCAAGTGTGATAAATGTGG - Intergenic
1163954432 19:20622922-20622944 TCCTGCAAATGTAATGAATTTGG - Exonic
1163954611 19:20625089-20625111 CCCTACAAGTGTGATAAATGTGG - Exonic
1163961395 19:20697451-20697473 TCCTGCAAATGTAATGAATTTGG + Intronic
1163985785 19:20949367-20949389 CCCTACAAATGTAAAGAATGTGG + Exonic
1163985800 19:20949535-20949557 CCCTACAAATGTAAAAAATGTGG + Exonic
1163985809 19:20949619-20949641 CCCTACAAATGTGAAAAATGTGG + Exonic
1164002782 19:21119590-21119612 TCATGCAAATGTAGTAAATTTGG + Exonic
1164009155 19:21182910-21182932 CCTTTCAAATGTAAAAAATGTGG + Exonic
1164009314 19:21184998-21185020 TTGTGCAAATATAATAAATTTGG + Exonic
1164012746 19:21220984-21221006 TCTTGCAAATGTAATAAATTTGG - Intergenic
1164012801 19:21222018-21222040 CCCTACAAATGTGAAAAATGTGG - Intronic
1164019993 19:21293100-21293122 CCCTACAAATGTAAAGAATGTGG - Exonic
1164019999 19:21293184-21293206 TCCTACAAATGTGATAAATGTGG - Exonic
1164020020 19:21293437-21293459 CCCTACAAATGTAAAGAATGTGG - Exonic
1164028980 19:21383153-21383175 CCTTTCAAATGTAAAAAATGTGG + Intergenic
1164029107 19:21384915-21384937 CACTACAAATGTAAAAAATGTGG + Intergenic
1164032746 19:21423200-21423222 CCTTTCAAATGTAAAAAATGTGG + Exonic
1164032832 19:21424373-21424395 CCCTACAAATGTAAAGAATGTGG + Exonic
1164032858 19:21424709-21424731 CCCTACAAATGTGAAAAATGTGG + Exonic
1164032922 19:21425601-21425623 CCCTACAAATGTGAAAAATGTGG + Exonic
1164032931 19:21425685-21425707 CCCTACAAATGTGAAAAATGTGG + Exonic
1164032981 19:21426643-21426665 TCTTGCAAATGTAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164045574 19:21536819-21536841 CCCTACAAATGTAAAGAATGTGG + Exonic
1164045584 19:21536903-21536925 CCCTACAAATGTGATGAATGTGG + Exonic
1164045590 19:21536987-21537009 CCCTACAAATGTAAAGAATGTGG + Exonic
1164045783 19:21539030-21539052 TCCAGCAAGTGTAATAAATTTGG + Intronic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164067167 19:21726674-21726696 CCCTACAAATGTGAAAAATGTGG - Exonic
1164074975 19:21806969-21806991 CCCTACAAATGTAATCAGTTTGG - Intronic
1164075013 19:21807734-21807756 CCCTACAAATGTAAAGAATGTGG - Exonic
1164075025 19:21807902-21807924 CCCTACAAATGTGAAAAATGTGG - Exonic
1164092373 19:21969602-21969624 CCCTGCAAATTTAATAAATTTGG - Intronic
1164092605 19:21972518-21972540 CCCTACAAATGTAAAGAATGTGG - Exonic
1164092648 19:21973022-21973044 CCCTACAAATGTAAAGAATGTGG - Exonic
1164092657 19:21973106-21973128 CCCTACAAATGTAAAGAATGTGG - Exonic
1164092736 19:21973994-21974016 CCCTACAAATGTAAAGAATGTGG - Exonic
1164092745 19:21974078-21974100 CCCTACAAATGTAAAGAATGTGG - Exonic
1164108233 19:22128784-22128806 CCCTGCAAATTTAATGAATTTGG - Intergenic
1164112293 19:22178711-22178733 CCGTGCAAATTTAATAAATTTGG - Intergenic
1164125746 19:22315128-22315150 CCCTGCAAATGTGAAGAATGTGG + Exonic
1164125782 19:22315632-22315654 CCCTGCAAATGTGAAGAATGTGG + Exonic
1164125801 19:22315884-22315906 CCCTGCAAATGTGAAGAATGTGG + Exonic
1164125922 19:22317389-22317411 CCCTACAAATGTAAAGAATGTGG + Intergenic
1164133837 19:22392588-22392610 CCCTACAAATGTAAAGAATGTGG - Exonic
1164164972 19:22664171-22664193 CCCTACAAATGTAAAGAATGTGG + Exonic
1164166773 19:22685557-22685579 CCCTACAAATGTAAAGAATGTGG + Intergenic
1164174118 19:22753471-22753493 ACCTGCAAATGTAATAAATTTGG - Intergenic
1164174432 19:22757358-22757380 CCCTGCAAATGTGAAGAATGTGG - Exonic
1164174451 19:22757609-22757631 CCCTGCAAATGTGAAGAATGTGG - Exonic
1164174529 19:22758617-22758639 CCCTGCAAATGTGAAGAATGTGG - Exonic
1164174568 19:22759121-22759143 CCCTGCAAATGTGAAGAATGTGG - Exonic
1164174572 19:22759205-22759227 CCCTACAAATATAAGAAATGTGG - Exonic
1164184954 19:22857741-22857763 CCCTACAAATGTAAAGAATGTGG + Intergenic
1164196805 19:22974563-22974585 CCCTGCAAATTTAATGAATTTGG - Intergenic
1164196870 19:22975459-22975481 CCCTACAAATGTGAAAAATGTGG - Exonic
1164196940 19:22976300-22976322 CCCTGCAAATGTGAAGAATGTGG - Exonic
1164196973 19:22976636-22976658 CCCTGCAAATGTGAAGAATGTGG - Exonic
1164223614 19:23221430-23221452 CTCTGCAAAGGTAGTAAATTTGG - Intergenic
1164223703 19:23222458-23222480 CCCTACAAATGTAAAGAATGTGG - Exonic
1164223723 19:23222710-23222732 CCCTACAAATGTAAAGAATGTGG - Exonic
1164223738 19:23222878-23222900 CCCTACAAATGTAAAGAATGTGG - Exonic
1164238402 19:23359560-23359582 CCCTACAAATGTGAAAAATGTGG - Exonic
1164238473 19:23360484-23360506 CCCTACAAATGTAAAGAATGTGG - Exonic
1164238489 19:23360652-23360674 CCCTTCAAATGTAAAGAATGTGG - Exonic
1164238507 19:23360988-23361010 CCCTACAAATGTAAAGAATGTGG - Exonic
1164238530 19:23361324-23361346 CCCTACAAATGTAAAGAATGTGG - Exonic
1164238552 19:23361576-23361598 CCCTTCAAATGTAAAGAATGTGG - Exonic
1164238570 19:23361912-23361934 CCCTACAAATGTAAAGAATGTGG - Exonic
1164252374 19:23491179-23491201 CCCTGCCAATGTAATAAATTTGG - Intergenic
1164252402 19:23491876-23491898 CCCTACAAATGGAAAAAATTTGG - Intergenic
1164252440 19:23492381-23492403 CCCTACAAATGTGAAAAATGTGG - Intergenic
1164269050 19:23653728-23653750 CCCTACAAATGTAAAGAATGTGG - Exonic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
1164287454 19:23831964-23831986 TCCTACAAATGTAAAAAATGTGG + Intergenic
1164287566 19:23833218-23833240 CCCTACAAATGGGAAAAATTTGG + Intergenic
1164287596 19:23833933-23833955 CCCTGCAAATATAATAAATTTGG + Intergenic
1164298004 19:23932966-23932988 CCCTGCAAATGTGAAGAATGTGG + Exonic
1164298106 19:23934218-23934240 CCCTACAAATGTGAAAAATGTGG + Exonic
1164298282 19:23936076-23936098 CCCTGCAAATGTAATGAATTTGG + Intronic
1164319361 19:24127633-24127655 CCCTACAAATGTGAAAAATGTGG + Exonic
1164319385 19:24127885-24127907 CCCTACAAATGGGAAAAATTTGG + Exonic
1164319423 19:24128580-24128602 CCCTGCAAGTATAATGAATTTGG + Exonic
1165543617 19:36514310-36514332 CCCTATGAATGTAATAAATGTGG - Exonic
1165543623 19:36514394-36514416 CCCTACAAATGTAATGAATGTGG - Exonic
1165589069 19:36950318-36950340 CCCTATAAATGTAATAAATGTGG + Exonic
1165589105 19:36950822-36950844 CCATTCAAATGTAATGAATGTGG + Exonic
1165589113 19:36950906-36950928 CCCTATGAATGTAATAAATGTGG + Exonic
1165641265 19:37389370-37389392 CCCTTCAAATGTAGTGAATGTGG + Exonic
1165643601 19:37412823-37412845 CCCTATGAATGTAATAAATGTGG - Exonic
1165659598 19:37565154-37565176 CCCTACAAATGTAAGGAATGTGG - Exonic
1165673366 19:37698851-37698873 CCCTACAAATGTAAGGAATGTGG - Exonic
1165684146 19:37803612-37803634 CCCTACAAATGTAAAGAATGTGG + Intronic
1166019617 19:40014420-40014442 CCCTATAAATGTAATGAATGTGG + Exonic
1166019673 19:40015092-40015114 CCCTACATATGTAATGAATGTGG + Exonic
1166019695 19:40015344-40015366 CCCTACATATGTAATGAATGTGG + Exonic
1166578823 19:43873384-43873406 CCCTACAAATGTAAAGAATGTGG - Exonic
1166614924 19:44235103-44235125 CCCTGCAAAGGTAATGAATATGG + Exonic
1166628846 19:44387280-44387302 CCCTACAAATGTAAAGAATGTGG - Exonic
1166638397 19:44472401-44472423 CCCTACAAATGTAAAGAATGTGG + Intergenic
1167536932 19:50059698-50059720 CCCTACAAATGTAACAAGTGTGG - Intergenic
1167835269 19:52063196-52063218 CCTTGCAAATGTAATTAACGTGG - Intronic
1167835542 19:52065570-52065592 CCTTACAAATGTAATGAATGTGG - Exonic
1167835612 19:52066326-52066348 CCTTACAAATGTAATGAATGTGG - Exonic
1167835617 19:52066410-52066432 CCCTACAAATGTAATGAATGTGG - Exonic
1167835625 19:52066494-52066516 CCTTACAAATGTAATGAATGTGG - Exonic
1167835639 19:52066662-52066684 CCCTACAAATGTAATGAATGTGG - Exonic
1167835652 19:52066830-52066852 CCCTACATATGTAATGAATGTGG - Exonic
1167840679 19:52115920-52115942 CCTTGCAAATGCAATGAATGTGG - Exonic
1167840697 19:52116172-52116194 CCCTTCAAATGTAATGAGTGTGG - Exonic
1167840712 19:52116340-52116362 CCCTACATATGTAATGAATGTGG - Exonic
1167845009 19:52155164-52155186 CCTTACAAATGTAATGAATGTGG - Exonic
1167845021 19:52155332-52155354 CCTTACAAATGTAATGAATGTGG - Exonic
1167845094 19:52156172-52156194 CCTTACAAATGTGATAAATGTGG - Exonic
1167845142 19:52156760-52156782 CCGTACAAATGTAATGAATGTGG - Exonic
1167861832 19:52290767-52290789 CTTTACAAATGTAATAAATGTGG + Exonic
1167865416 19:52322190-52322212 CCTTACAAATGTAATGAATGTGG + Exonic
1167865428 19:52322358-52322380 CCTTACAAATGTAATGAATGTGG + Exonic
1167865434 19:52322442-52322464 CCTTACAAATGTAATGAATGTGG + Exonic
1167865437 19:52322526-52322548 CCTTACAAATGTAATGAATGTGG + Exonic
1167865451 19:52322694-52322716 CCTTACAAATGTAATGAATGTGG + Exonic
1167870571 19:52366405-52366427 CCTTACAAATGTAATGAATGTGG + Exonic
1167870576 19:52366489-52366511 CCCTACAAATGTAACGAATGTGG + Exonic
1167872553 19:52384631-52384653 CTTTACAAATGTAATAAATGTGG + Exonic
1167872567 19:52384799-52384821 CCTTACAAATGTAATGAATGTGG + Exonic
1167876312 19:52416158-52416180 CCTTACAAATGTAATAAATGTGG + Exonic
1167876331 19:52416410-52416432 CCTTACAAATGTAATCAATGTGG + Exonic
1167878886 19:52438517-52438539 CCATACAAATGTAATGAATGTGG + Exonic
1167882651 19:52474050-52474072 CCTTACAAATGTAATGAATGTGG - Intronic
1167882669 19:52474302-52474324 CCTTACAAATGTAATGAATGTGG - Intronic
1167882678 19:52474454-52474476 CCTTACAAATGTAATGAATGTGG - Intronic
1167882704 19:52474873-52474895 CCTTACAAATGTAATGAATGCGG - Intronic
1167899975 19:52613177-52613199 CCTTTCAAATGTAATGAATGTGG - Exonic
1167899999 19:52613513-52613535 CCTTACAAATGTAATGAATGTGG - Exonic
1167923060 19:52799167-52799189 CCCTACAAGTGTAATGAATGTGG - Exonic
1167938746 19:52928558-52928580 CCTTGCAAGTGTAATGAATGTGG - Exonic
1167941574 19:52950399-52950421 CCATACAAGTGTAATAAATGTGG - Exonic
1167956410 19:53068318-53068340 CCTTACAAATGTAATGAATGTGG - Exonic
1167956430 19:53068486-53068508 CCTTACAAATGTAATCAATGTGG - Exonic
1167956494 19:53069242-53069264 CCTTACAAATGTAATGAATGTGG - Exonic
1167956506 19:53069410-53069432 CCGTTCAAATGTAATGAATGTGG - Exonic
1167961542 19:53108624-53108646 CCTTACAAATGTAATCAATGTGG - Exonic
1167965425 19:53141272-53141294 CCTTACAAATGTAATGAATGTGG - Exonic
1167965455 19:53141608-53141630 CCTTACAAATGTAATGAATGTGG - Exonic
1167968092 19:53164679-53164701 CCTTACAAATGTAATGAATGTGG - Exonic
1167968150 19:53165435-53165457 CCTTACAAATGTAATGAATGTGG - Exonic
1167968178 19:53165771-53165793 CCTTACAAATGTAATGAATGTGG - Exonic
1167977146 19:53237669-53237691 CCTTACAAATGTAATGAATGTGG - Exonic
1167990172 19:53353331-53353353 CCTTACAAGTGTAATAAATGTGG + Exonic
1167993587 19:53383063-53383085 GCTTGCAAGTGTAATAAATGTGG + Exonic
1168002069 19:53455648-53455670 CCCTACAAATGTAATGAGTGTGG + Exonic
1168633830 19:57978791-57978813 CCCTATGAATGTAATAAATGTGG - Exonic
1168633875 19:57979295-57979317 CCCTATGAATGTAATAAATGTGG - Exonic
1168678330 19:58295204-58295226 CCCTTCAAATGTAATCAGTGTGG + Exonic
1202664089 1_KI270708v1_random:101112-101134 CCCTACAAATGTATTGAATGTGG + Intergenic
928041970 2:27887500-27887522 CCCTGCATCTGTGATAAACTTGG - Intronic
929019272 2:37535353-37535375 CCTTAAAAATGTAATAAATTTGG - Intergenic
929678077 2:43958212-43958234 CCCTGTAATTGTACTAAAATGGG + Intronic
930491315 2:52076110-52076132 CCCTGTGAATGTAAAAAATGTGG + Intergenic
931624685 2:64246363-64246385 CCATACATATGTAATTAATTAGG + Intergenic
932799057 2:74723345-74723367 CACTGCAGATGTAATTAGTTAGG - Intergenic
933090373 2:78110054-78110076 CCCAGCAAATGATATTAATTGGG + Intergenic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
933970726 2:87467959-87467981 CCCTGTAAATGTGGTAAATGAGG + Intergenic
934537680 2:95149352-95149374 CCCTACAAATGTAATGAGTGTGG - Exonic
934537686 2:95149436-95149458 CCTTACAAATGTAATAAATGTGG - Exonic
934537705 2:95149604-95149626 CCCTACAAATGTAATGAATGTGG - Exonic
935072598 2:99708564-99708586 GCCTTCAAAAGTACTAAATTTGG - Intronic
935748177 2:106207834-106207856 CCTTATAAATGCAATAAATTTGG + Intergenic
938523816 2:132103504-132103526 CCCTGCAAATGTGAAGAATGTGG + Intergenic
938523910 2:132105197-132105219 CCATACAAATGTAATAAATGTGG + Intergenic
938527794 2:132151037-132151059 CCCTAAGAATGTAATAAATTTGG - Intronic
938544772 2:132317906-132317928 CCCTACAAATGTAAAGAATGTGG + Intergenic
938852801 2:135278794-135278816 ACCTGTAAATGTTATAAATATGG + Intronic
940181746 2:150941978-150942000 AACTGCAACTATAATAAATTTGG - Intergenic
940905202 2:159162877-159162899 CCCAGCAAATGTTTTTAATTTGG + Intronic
943963057 2:194292535-194292557 CGCTGCTAATGTAATCACTTAGG - Intergenic
944939048 2:204603223-204603245 GACTGCAAATTTAATAAAATAGG - Intronic
945155874 2:206836687-206836709 CCCTACAAATTTAATATACTAGG - Intergenic
945158741 2:206866495-206866517 GCCTGCTAATGTAAAAAAATGGG + Intergenic
946523703 2:220495110-220495132 TCCTGCAAGTGAAACAAATTTGG - Intergenic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
1169955222 20:11095022-11095044 TCCTGAAAGTGTAATACATTAGG - Intergenic
1171750853 20:29047025-29047047 CACTGCAAATAAAATAAAGTTGG + Intergenic
1171804617 20:29663977-29663999 CTCTACTAATGTAATTAATTTGG + Intergenic
1173133273 20:40414640-40414662 TCCTTCAAATGTAATAAAATTGG + Intergenic
1173424838 20:42933322-42933344 CCCTGCAAATAGGATCAATTTGG + Intronic
1173520075 20:43693018-43693040 GCCTGCAAATGTAATACTATAGG - Intronic
1174011276 20:47451594-47451616 CTCTGCAATTGCAATAATTTAGG - Intergenic
1174637475 20:52014088-52014110 CCCAGCTAATTTAAAAAATTTGG + Intergenic
1174686689 20:52463089-52463111 CAGTGCACATGTCATAAATTAGG + Intergenic
1175028370 20:55927599-55927621 GCCTGCACATGTTATAAATAGGG + Intergenic
1175617479 20:60413270-60413292 CCCTGTAAATTTAATGATTTGGG - Intergenic
1176313910 21:5223896-5223918 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1176582574 21:8545104-8545126 CTCTACAAATGTAATTCATTTGG + Intergenic
1176768722 21:13048883-13048905 CTCTAAGAATGTAATAAATTTGG + Intergenic
1176772716 21:13095405-13095427 CCATACAAATGTAATAAATGTGG - Intergenic
1176772815 21:13097095-13097117 CCCTGCAAATGTGAAGAATGTGG - Intergenic
1176772859 21:13097683-13097705 CCCTACAAATGTGATGAATGTGG - Intergenic
1177056192 21:16304930-16304952 ACATGCAAATGTAATAAAACTGG + Intergenic
1177585657 21:23091223-23091245 CCCTATAAATGTAAGAAATGTGG - Intergenic
1178966164 21:37120428-37120450 CTCTGCAAATTTAGTAGATTTGG + Intronic
1179015623 21:37592520-37592542 CTTTGCAAATGTAATTAGTTGGG - Intergenic
1180265405 22:10522152-10522174 CTCTACAAATGTAATTCATTTGG + Intergenic
1180330816 22:11477996-11478018 CCCTACAAATGTATTGAATGTGG + Intergenic
1180391729 22:12290013-12290035 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1180408016 22:12574743-12574765 CTCTGCAAATAAAATAAAGTTGG + Intergenic
1180437509 22:15324898-15324920 CCATACAAATGTAATAAATGTGG - Intergenic
1180520359 22:16195115-16195137 ACATACAAATGTAATAAATGTGG - Intergenic
1180520497 22:16197400-16197422 CCCTACAAATGTGATGAATTTGG - Intergenic
1184885462 22:47342427-47342449 CCCTCTAATTGTAATAAATTAGG - Intergenic
953628942 3:44595010-44595032 CCCTATAAATGTAATGAATGTGG + Exonic
955914969 3:63898734-63898756 TCCTGCAATTTTAACAAATTTGG - Intronic
957091863 3:75738505-75738527 CCCTACAAATGTATTGAATGTGG - Intronic
958727338 3:97921828-97921850 CCATGGAAATGCAATAAAATAGG - Intronic
959035342 3:101356743-101356765 TCCTGCAAATGTAATGAATTTGG - Intronic
959035469 3:101358167-101358189 CCCTACAAATGTGATCAATGTGG + Intronic
960763621 3:121099728-121099750 CCCTGCAAATTTAAGGAATGTGG + Intronic
962827449 3:139110340-139110362 ACCAGCAAATCTAATAAAGTCGG - Intronic
964116791 3:153144451-153144473 CATTGTAAATGTAATATATTAGG - Intergenic
964437524 3:156669915-156669937 CCCTGCAAAAAAAAAAAATTTGG + Intergenic
964701952 3:159577734-159577756 ACCTGCAAAGGGATTAAATTTGG - Intronic
965720778 3:171659602-171659624 CACTGCAAATTTAATCAATGGGG + Intronic
967762262 3:193239845-193239867 CCTAGCAAACATAATAAATTTGG + Intergenic
968380044 4:86099-86121 CCCTACAAATGTGAAAAATGTGG + Exonic
968380065 4:86351-86373 CCCTACAAATGTAAAGAATGTGG + Exonic
968380073 4:86435-86457 CCCTACAAATGTAAAGAATGTGG + Exonic
968380122 4:87023-87045 CCCTACAAATGTAAAGAATGTGG + Exonic
968388039 4:162033-162055 CCCTACAAATGTAAAGAATGCGG + Exonic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
968397379 4:254678-254700 CCCTACAAATGTAAAGAATGTGG + Intergenic
968398926 4:270916-270938 CCCTACAAATGTAAAGAATGTGG - Exonic
968409324 4:373533-373555 CCCTACAAATGTGATGAATGTGG + Exonic
968409435 4:375015-375037 CCCTGGAAATGCAAAAAATGTGG + Exonic
968409452 4:375380-375402 TCCTACAAATGTAATAAATGTGG + Intronic
968416543 4:441005-441027 TCCTACAAATGTAATAAATGTGG - Intronic
968416606 4:442107-442129 CCCTACAAATGTAAGGAATGTGG - Exonic
968416690 4:443031-443053 CCCTACAAATGTAAGCAATGTGG - Exonic
968416698 4:443115-443137 CCCTACAAATGTAAAGAATGTGG - Exonic
968416752 4:443703-443725 CCCTACAAATGTAAGGAATGTGG - Exonic
968416761 4:443787-443809 CCCTACAAATGTAAAGAATGTGG - Exonic
969469333 4:7378167-7378189 CCATGAAAATGAAATGAATTTGG + Intronic
971288557 4:25313262-25313284 CCCTTCAAAAATAAAAAATTAGG + Intronic
972049727 4:34714352-34714374 CCCTGTGAATGTAAGAAATGTGG + Intergenic
972049881 4:34716463-34716485 CCCTGTGAATGTAAGAAATGTGG - Intergenic
972829363 4:42796769-42796791 ACATACAAATGTAATAATTTTGG - Intergenic
974090571 4:57306283-57306305 CCCTGCACATGCAATCAATAAGG - Intergenic
974422996 4:61702364-61702386 CCATGCAAATGGCATAAAATTGG - Intronic
975499467 4:75068887-75068909 CTCTGCAAATCTAAGATATTTGG + Intergenic
976400770 4:84604427-84604449 CCTTGTCCATGTAATAAATTTGG + Intronic
976731051 4:88262019-88262041 CCATGCAAAAGAAATTAATTTGG - Exonic
978634354 4:110786026-110786048 ACCTGGAAAAGTAATAAATTTGG - Intergenic
978879608 4:113685572-113685594 CCCGTGAAAGGTAATAAATTAGG + Intronic
979646158 4:123071929-123071951 CCTTTCAACTGTAATAAATAAGG + Intronic
981675761 4:147341115-147341137 CCCTGAGAATGGAATAAATTAGG + Intergenic
982345067 4:154348365-154348387 CCATGGAAAGGTCATAAATTTGG + Intronic
982366102 4:154580704-154580726 CCCTGAAAAAATAACAAATTGGG + Intergenic
983099412 4:163606764-163606786 CCCTCCAAATCTTATGAATTGGG - Intronic
983944135 4:173567409-173567431 CCCTGGAAATGGACTAAATGGGG - Intergenic
984320950 4:178195908-178195930 CCCTGCAGATATAATATGTTGGG + Intergenic
985099504 4:186444426-186444448 CCCTACAATTGTAAGTAATTTGG + Intronic
986837369 5:11653854-11653876 CCCTGAAAATGTAACAATTCTGG - Intronic
988059391 5:26148293-26148315 CCATAAAAATGTAAAAAATTGGG + Intergenic
988317506 5:29649617-29649639 ACCTGAAAAGGAAATAAATTTGG + Intergenic
990315153 5:54576642-54576664 CACTGCTACTGTAATAAAGTGGG - Intergenic
990344451 5:54857621-54857643 CCCTACAAATGTAAGGAATGTGG + Intergenic
991050946 5:62272497-62272519 CACTGCAAATGTTATAGATGGGG - Intergenic
992949446 5:81843334-81843356 AGCTGCAAAAGTAATAAATAGGG + Intergenic
994956802 5:106543382-106543404 CCCTATAAATGTAATGAACTTGG - Intergenic
995606108 5:113856937-113856959 TCCTGCAAATTTACTGAATTTGG + Intergenic
996940850 5:129003668-129003690 CTCTACAAAAGTAAAAAATTAGG + Intronic
998065440 5:139154334-139154356 CCCTGGAAATGTAACAGAATTGG - Intronic
999357524 5:150950258-150950280 CCCTATAAATGTACTAAATGTGG - Intergenic
999405684 5:151304641-151304663 CCCTAAAAATGAAATAAAATAGG + Intergenic
1002150627 5:177226953-177226975 CCCTACAGTTGTTATAAATTTGG - Intronic
1002366061 5:178712211-178712233 CCCTTTAAATGTAATACATGTGG - Exonic
1002387967 5:178884097-178884119 CCCTTTAAATGTAATACATGTGG + Exonic
1002393166 5:178931782-178931804 CCCTATAAATGTAATGAATGTGG + Exonic
1002393181 5:178931950-178931972 CCCTACAAATGTAATGAATGTGG + Exonic
1002393200 5:178932202-178932224 CCTTACAAATGTAACAAATGCGG + Exonic
1002397041 5:178965887-178965909 CCCTATAAATGTAATAAATGTGG + Exonic
1002406108 5:179033227-179033249 CCCTACAAATGTAATGAATGTGG + Exonic
1003395427 6:5748840-5748862 GCCTGCAACTGTAAAAGATTGGG + Intronic
1004281001 6:14279810-14279832 CCCTGGAAATATGATTAATTAGG + Intergenic
1004285958 6:14321007-14321029 CTCTGCAGATGTAAAAAATAAGG - Intergenic
1005593883 6:27358884-27358906 CCCTACAAATATAATGAATATGG - Intergenic
1005598350 6:27401028-27401050 CCTTACAAATGTAATGAATGTGG + Exonic
1005672048 6:28116320-28116342 CCCTGCAAATGTGATGCATATGG + Intergenic
1006006123 6:31003099-31003121 CCCGGCAAATATAATACATTTGG + Intergenic
1006917749 6:37605952-37605974 CACTGTAAATGCAACAAATTTGG + Intergenic
1012384570 6:98664338-98664360 CCCTACACATGAATTAAATTAGG - Intergenic
1012483918 6:99699179-99699201 CACTGCAAATTTAAAAAATCAGG + Intergenic
1013643011 6:112106636-112106658 ACCTGGAAATGTAAGAAATGTGG - Intergenic
1014068963 6:117159351-117159373 CTTTGCAGATGTAATTAATTAGG - Intergenic
1014297142 6:119633141-119633163 CCCTTCAGCTGCAATAAATTTGG - Intergenic
1014311434 6:119807080-119807102 CCCCCCAAATGGAATGAATTTGG + Intergenic
1015158056 6:130120162-130120184 CCCTGAGAATGGAATACATTAGG + Intronic
1015532077 6:134230711-134230733 CTCTACAAATAAAATAAATTAGG + Intronic
1016166750 6:140954867-140954889 CCATGAAAATGTAGTAAATACGG - Intergenic
1016327106 6:142915261-142915283 CCTTGCAGATGTAATTAGTTAGG + Intronic
1016773976 6:147883793-147883815 CACTGCAAATGTAATAATAAAGG + Intergenic
1017694857 6:157004261-157004283 CCATGGAAATGTCTTAAATTTGG + Intronic
1017916816 6:158837461-158837483 CATTGCAAATGTAATTAGTTTGG - Intergenic
1018584680 6:165344242-165344264 CCCTGCAATTTGAATAGATTTGG + Intronic
1020048634 7:5064402-5064424 CCCTATAAATGTAATGAATGTGG + Exonic
1020988859 7:15170639-15170661 CTCTGCTAATGTAATTAAATTGG - Intergenic
1021311752 7:19106205-19106227 CCTTTGAAATGTAATAGATTGGG - Intronic
1021662226 7:22931084-22931106 CTCTGCAAATGAAATTAGTTAGG + Intergenic
1022660388 7:32361447-32361469 CCTAGCAAATGTAATAAAGAAGG - Intergenic
1024382995 7:48721353-48721375 TCCTTCAAATGTGAAAAATTGGG + Intergenic
1025075547 7:55939695-55939717 CCCTATAAATGTAATCAATGTGG + Exonic
1025075561 7:55939863-55939885 CCCTATAAATGTAATGAATGCGG + Exonic
1025159249 7:56639327-56639349 CCCTACAAATGTAATGAATGTGG - Intergenic
1025159256 7:56639411-56639433 CCCTACAAATGTAATGAATGTGG - Intergenic
1025159280 7:56639663-56639685 TCCTACAAATGTAATGAATGTGG - Intergenic
1025226132 7:57165313-57165335 CCCTACAAATGTGAAAAATGTGG - Intergenic
1025707163 7:63876659-63876681 CCCTACAAATGTGAAGAATTTGG + Intergenic
1025727254 7:64077980-64078002 CCCTACAAATGTAATGAATGTGG + Intronic
1025727309 7:64078567-64078589 CCTTACAAATGTAATGAATGTGG + Intronic
1025727340 7:64078899-64078921 CCCTACAAATGTAATGAATGTGG + Intronic
1025743281 7:64220273-64220295 CCCTACAAATGTAAATAATGTGG + Intronic
1025748284 7:64266684-64266706 CCCTACAAATGTAAAGAATGTGG + Exonic
1025756430 7:64348293-64348315 ACCTGTCAATGTAATAAATGTGG + Exonic
1025756461 7:64348797-64348819 CCCTACACATGTAATGAATGTGG + Exonic
1025767505 7:64469459-64469481 CCCTTCAAATGTAAAGAATGTGG + Intergenic
1025767541 7:64469962-64469984 CCCTACAAATGTAAAGAATGTGG + Intergenic
1025767655 7:64471423-64471445 TCTTGCAAATGTAATAAATTTGG + Intergenic
1025772183 7:64520624-64520646 TCCTGCAAATGTAATGAATTTGG - Exonic
1025792807 7:64707115-64707137 CCCTACAAATGTAAAGAATGTGG + Exonic
1025792824 7:64707367-64707389 CCCTACAAATGTAAAGAATGTGG + Exonic
1025792962 7:64709289-64709311 CCCTACAAATGTAAAAAACGTGG + Exonic
1025792969 7:64709374-64709396 CCCTGCAAATGTGAATAATGTGG + Exonic
1025805758 7:64832410-64832432 CCCTACAAATGTAAAGAATGTGG + Intronic
1025817421 7:64928361-64928383 CCCTACAAATGCAATGAATGTGG + Exonic
1025822151 7:64975959-64975981 AACTGCAAATGTAATATATTTGG - Exonic
1025822216 7:64976878-64976900 CCCTGCAAATGTGAAGAATGTGG - Exonic
1025867530 7:65399216-65399238 CCCTACAAATGTGATGAATGTGG + Exonic
1025867547 7:65399384-65399406 CCCTACAAATGTGAAAAATGTGG + Exonic
1025867619 7:65400381-65400403 CCCTGCAAATGTAATAAATATGG + Exonic
1028360797 7:89964255-89964277 CTCTGTAAAAGTGATAAATTGGG + Intergenic
1030525033 7:110642310-110642332 AACTGCAAATGTAAGAAATTGGG + Intergenic
1031072167 7:117173795-117173817 CCTAGCAAATGTAATAAAGAAGG - Intronic
1031486262 7:122329639-122329661 TCCTCAAAATGTTATAAATTAGG - Intronic
1035248128 7:157578225-157578247 TCCTGTGAATGGAATAAATTTGG - Intronic
1038109040 8:24474113-24474135 CCCAGCCAATGTAATAAAAAAGG + Intronic
1039132241 8:34279360-34279382 TACTGCAAATGTAATGGATTTGG - Intergenic
1039726796 8:40226692-40226714 CCAAGCAAAAGTATTAAATTTGG - Intergenic
1040371944 8:46785502-46785524 CCCTACAAATGTAATGAATATGG + Intergenic
1040380930 8:46871331-46871353 CCCTACAAATGTAATGAATGTGG - Intergenic
1041218205 8:55622746-55622768 CCCTACAAATGTAAAGAATGTGG + Intergenic
1041390442 8:57342974-57342996 CACTTCATATGTACTAAATTTGG + Intergenic
1042748344 8:72131875-72131897 CCCTGCAAATATATTTAATAAGG + Intergenic
1042757955 8:72238465-72238487 CCATGCAAATCAAATACATTTGG - Intergenic
1045149125 8:99383381-99383403 CCCTGAAAATGGAATACTTTAGG - Intronic
1047163256 8:122405898-122405920 GTCTGCAGATGTGATAAATTTGG - Intergenic
1047955187 8:129969317-129969339 ACCTGCAAATGTCAAAAATGAGG - Intronic
1048556978 8:135488369-135488391 CCCAGTAAATGAAATAAATATGG - Intronic
1049151527 8:141038162-141038184 CTCTGCAATTGGAATTAATTAGG - Intergenic
1049555968 8:143282347-143282369 CCCTGCAAATGTAATGACTGTGG + Intergenic
1049834137 8:144722680-144722702 CCCTACAAGTGTAATGAATGTGG - Exonic
1049852803 8:144842761-144842783 CCCTATAAATGTAATGAATGTGG + Exonic
1049931395 9:460403-460425 GCCTGCCAATGTTATAAACTTGG + Intronic
1051903998 9:22074356-22074378 TCCTGCAGATAAAATAAATTGGG - Intergenic
1053077680 9:35148565-35148587 CCCTACAAATGTAAAGAATGTGG - Intergenic
1053383069 9:37664790-37664812 CCTTATAAATCTAATAAATTAGG + Intronic
1053702516 9:40710527-40710549 CCCTACAAATGTGATGAATGTGG + Intergenic
1053702560 9:40711115-40711137 CCCTGCAAATGTGAAGAATGTGG + Intergenic
1053702656 9:40712805-40712827 CCATACAAATGTAATAAATGTGG + Intergenic
1054412575 9:64833990-64834012 CCCTACAAATGTGATGAATGTGG + Intergenic
1054412619 9:64834578-64834600 CCCTGCAAATGTGAAGAATGTGG + Intergenic
1054412716 9:64836269-64836291 CCATACAAATGTAATAAATGTGG + Intergenic
1055304327 9:74913262-74913284 CCCTTTAAATGTAATAATATTGG - Intergenic
1055696271 9:78888451-78888473 CTCTGCAAATGTATTAAAAATGG + Intergenic
1056272656 9:84961874-84961896 CCTTGCAAATGGAACAATTTAGG - Intronic
1056330629 9:85518253-85518275 CCCAGCAAATGCAATAAAAAAGG + Intergenic
1057635322 9:96759433-96759455 CCCTATAAATGTAATGAATGTGG - Exonic
1057635334 9:96759601-96759623 CCCTATAAATGTAATGAATGTGG - Exonic
1057640685 9:96817984-96818006 CCCTATAAATGTGATAAATGTGG - Exonic
1057640728 9:96818404-96818426 CCCTACAAATGTAATCAGTGTGG - Exonic
1058154065 9:101492511-101492533 CTTTGCACATCTAATAAATTTGG + Intronic
1058185033 9:101845049-101845071 AACTGCAAATGGAAAAAATTTGG - Intergenic
1058232642 9:102447959-102447981 CTCAGCAAATGAAATAAATGAGG + Intergenic
1060097236 9:120802783-120802805 CCCTGCAACTTTACTGAATTTGG + Intergenic
1203612592 Un_KI270749v1:23116-23138 CTCTACAAATGTAATTCATTTGG + Intergenic
1187204081 X:17165525-17165547 CCCTGCAAATGGAATAAAAATGG - Intergenic
1188207032 X:27372885-27372907 CACTTCAAATATAATAAAATGGG + Intergenic
1189068884 X:37843442-37843464 CCATGTTAATGTAATTAATTAGG - Intronic
1190154420 X:47976528-47976550 CCCTATAAATGTAATGAATGTGG - Exonic
1194151850 X:90335611-90335633 GCCTGGAACTGTACTAAATTTGG + Intergenic
1194644032 X:96436566-96436588 CCCTGGGAATTTAATAATTTGGG - Intergenic
1195118140 X:101720495-101720517 ATCTACAAATGTAATAAATGTGG - Intergenic
1195118150 X:101720660-101720682 CCCTACAAATGTAATAATTTTGG - Intergenic
1195497740 X:105557164-105557186 TCCTGCAGATGTTATAACTTTGG + Intronic
1196192836 X:112812468-112812490 CCCTGCAAATCTCATAAAATGGG + Intronic
1197377386 X:125698308-125698330 CCCTGAAACTAAAATAAATTTGG - Intergenic
1198432498 X:136581418-136581440 CACTGAAGATGAAATAAATTCGG + Intergenic
1200860914 Y:7991772-7991794 CCCTGTCAATGTAATACATATGG - Intergenic
1200868297 Y:8069060-8069082 CCCTACAAATGTGAAAAATGTGG - Intergenic
1200899878 Y:8418921-8418943 CCCTACAAATGTGAAAAATGTGG - Intergenic
1200899929 Y:8419698-8419720 GCCTGTCAATGTAATAAATTTGG - Intergenic
1201988812 Y:20001659-20001681 CCTTTCAAATGTAATAAGTGTGG - Intergenic
1202265815 Y:23017663-23017685 CCCTACAAATGTGAAAAATGCGG + Intergenic
1202380425 Y:24272471-24272493 TCCTGTAATTGTAATTAATTGGG - Intergenic
1202418808 Y:24651406-24651428 CCCTACAAATGTGAAAAATGCGG + Intergenic
1202451978 Y:25018680-25018702 CCCTACAAATGTGAAAAATGCGG - Intergenic
1202490358 Y:25397654-25397676 TCCTGTAATTGTAATTAATTGGG + Intergenic