ID: 1164279102

View in Genome Browser
Species Human (GRCh38)
Location 19:23752696-23752718
Sequence CTCTGGGTTTGTAGTGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1162
Summary {0: 7, 1: 10, 2: 9, 3: 46, 4: 1090}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164279102_1164279111 -3 Left 1164279102 19:23752696-23752718 CCCTCTCCACTACAAACCCAGAG 0: 7
1: 10
2: 9
3: 46
4: 1090
Right 1164279111 19:23752716-23752738 GAGGGCATCTCATTACCCTGGGG 0: 1
1: 0
2: 13
3: 22
4: 125
1164279102_1164279112 -2 Left 1164279102 19:23752696-23752718 CCCTCTCCACTACAAACCCAGAG 0: 7
1: 10
2: 9
3: 46
4: 1090
Right 1164279112 19:23752717-23752739 AGGGCATCTCATTACCCTGGGGG 0: 1
1: 0
2: 1
3: 23
4: 160
1164279102_1164279110 -4 Left 1164279102 19:23752696-23752718 CCCTCTCCACTACAAACCCAGAG 0: 7
1: 10
2: 9
3: 46
4: 1090
Right 1164279110 19:23752715-23752737 AGAGGGCATCTCATTACCCTGGG 0: 1
1: 0
2: 8
3: 18
4: 128
1164279102_1164279109 -5 Left 1164279102 19:23752696-23752718 CCCTCTCCACTACAAACCCAGAG 0: 7
1: 10
2: 9
3: 46
4: 1090
Right 1164279109 19:23752714-23752736 CAGAGGGCATCTCATTACCCTGG 0: 1
1: 0
2: 7
3: 26
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164279102 Original CRISPR CTCTGGGTTTGTAGTGGAGA GGG (reversed) Intronic
900273465 1:1807288-1807310 TTGTGTTTTTGTAGTGGAGACGG - Intronic
900679412 1:3908118-3908140 CTCTGGGTTTGTGGGGGTGTTGG + Intergenic
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
901367942 1:8769958-8769980 CTTTGTGTTTTTAGTTGAGATGG + Intronic
901376315 1:8842196-8842218 TTCTGTATTTTTAGTGGAGATGG + Intergenic
901588721 1:10320869-10320891 TTTTGTGTTTTTAGTGGAGATGG + Intronic
901893239 1:12286246-12286268 CTTTGTGTTTTTAGTTGAGATGG + Intronic
902262983 1:15240784-15240806 TTTTGTGTTTTTAGTGGAGAAGG - Intergenic
902334526 1:15747429-15747451 CTCTGGGTTGTTGCTGGAGAGGG - Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902867890 1:19292534-19292556 TTTTGGATTTTTAGTGGAGATGG - Intergenic
903137506 1:21318982-21319004 CTGTGGGTTTTCAGTGGAGCTGG + Intronic
903586552 1:24419909-24419931 CTTTGTGTTTTTAGTAGAGACGG - Intronic
905154810 1:35967585-35967607 TTTTGTGTTTGTAGTAGAGATGG + Intronic
905295340 1:36951096-36951118 TTCTGGCTTTGTAGAGGAGCTGG + Intronic
905419963 1:37834801-37834823 CTCTGGTTTTCTAGTGGCAAAGG - Intronic
905557748 1:38900448-38900470 TTTTGTGTTTTTAGTGGAGATGG - Intronic
905716129 1:40151373-40151395 TTCTGCGTTTTTAGTAGAGATGG - Intergenic
905755317 1:40504480-40504502 TTCTGTATTTGTAGTAGAGATGG + Intergenic
905797467 1:40823727-40823749 CTCTGGATTTTAAGGGGAGATGG - Intronic
906074791 1:43044075-43044097 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
906385981 1:45368923-45368945 GTGTGTGTTTTTAGTGGAGATGG + Intronic
906404011 1:45527209-45527231 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
906473746 1:46152733-46152755 TTTTGGATTTTTAGTGGAGATGG + Intronic
906897108 1:49787328-49787350 TTCTGTATTTTTAGTGGAGACGG - Intronic
906977139 1:50588114-50588136 TTTTGTGTTTTTAGTGGAGATGG - Intronic
907006740 1:50921994-50922016 TTTTGTGTTTTTAGTGGAGACGG - Intronic
907399168 1:54213875-54213897 CTTTGTGTTTTTAGTAGAGATGG - Intronic
908805989 1:67933036-67933058 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
909328833 1:74388105-74388127 CTTTGTGTTTCTAGTAGAGATGG - Intronic
909651440 1:77980053-77980075 TTTTGCGTTTGTAGTAGAGACGG + Intronic
909949759 1:81705416-81705438 TTTTGTGTTTTTAGTGGAGACGG + Intronic
910198016 1:84665928-84665950 GGCGGGGTCTGTAGTGGAGAGGG + Intronic
910551132 1:88476539-88476561 TTCTGTATTTTTAGTGGAGATGG - Intergenic
911028371 1:93459102-93459124 TTCTGTATTTTTAGTGGAGACGG - Intronic
911051273 1:93673654-93673676 CTCTGGGTTTGTAATGGGCCTGG - Intronic
911724349 1:101226304-101226326 CTTTGTATTTTTAGTGGAGACGG - Intergenic
912271977 1:108220768-108220790 TTCTGTGTTTGTACTGGAGGTGG + Intergenic
912837586 1:113009936-113009958 TTTTGTATTTGTAGTGGAGAGGG - Intergenic
912923421 1:113891728-113891750 CTTTGTATTTTTAGTGGAGACGG + Intergenic
913009033 1:114664648-114664670 TTCTGTGTTTTTAGTAGAGATGG + Intronic
913281189 1:117186658-117186680 ATCTGGACTTGAAGTGGAGAGGG - Intronic
913984269 1:143551102-143551124 CTCTGGGTTTGGAGTTAAGCTGG - Intergenic
914422476 1:147541875-147541897 CTCTGGGTTGGTGGGGGAGAAGG + Intronic
914674383 1:149897306-149897328 TTTTGTGTTTTTAGTGGAGACGG - Intronic
914754525 1:150555158-150555180 TTTTGTATTTGTAGTGGAGATGG + Intronic
914790007 1:150869303-150869325 TTTTGTGTTTTTAGTGGAGATGG - Intronic
915062097 1:153194753-153194775 CTCTGAGTTTGGAGTAGACATGG + Intergenic
915171292 1:153979376-153979398 TTCTGTATTTTTAGTGGAGACGG - Intergenic
916184871 1:162121296-162121318 TTCTGTATTTTTAGTGGAGACGG + Intronic
917023993 1:170621640-170621662 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
918261242 1:182798396-182798418 TTTTGTGTTTGTAGTAGAGACGG + Intronic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
919034843 1:192293371-192293393 TTTTGGATTTGTAGTAGAGATGG + Intergenic
919244512 1:194963566-194963588 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
919634390 1:199989466-199989488 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
920112902 1:203599526-203599548 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
920282069 1:204851501-204851523 TTTTGTGTTTTTAGTGGAGATGG + Intronic
921087013 1:211803927-211803949 TTCTGTATTTTTAGTGGAGATGG + Intronic
922040725 1:221893716-221893738 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
922247047 1:223809994-223810016 TTCTGTATTTTTAGTGGAGATGG + Intronic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922522827 1:226272224-226272246 TTTTGTGTTTTTAGTGGAGACGG + Intronic
922687227 1:227651120-227651142 TTCTGGGTTCATAGTAGAGAGGG + Intronic
922732741 1:227959786-227959808 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
922797388 1:228347167-228347189 CTCTGTGTTTGCGGTAGAGACGG - Intronic
923011228 1:230089329-230089351 GTGTGTGTTTTTAGTGGAGATGG + Intronic
923861850 1:237899528-237899550 CTCTGTATTTTTAGTAGAGACGG + Intergenic
924091939 1:240510195-240510217 CTTTGTATTTTTAGTGGAGACGG - Intronic
924551768 1:245084664-245084686 CTCTAGCTTTGTATGGGAGAAGG - Intronic
1062811866 10:472627-472649 CTCTGGCTTTGCTGTGGGGATGG - Intronic
1063201558 10:3788831-3788853 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1063456911 10:6190112-6190134 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1063488848 10:6444951-6444973 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1063574181 10:7246546-7246568 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1063599634 10:7468672-7468694 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1063700593 10:8380850-8380872 TTTTGTATTTGTAGTGGAGACGG - Intergenic
1063701287 10:8387647-8387669 TTTTGGATTTGTAGTAGAGACGG + Intergenic
1064263559 10:13806026-13806048 TTCTGTATTTTTAGTGGAGACGG + Intronic
1064267388 10:13836166-13836188 TTCTGTATTTGTAGTAGAGACGG + Intronic
1064523450 10:16228324-16228346 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1064598537 10:16970402-16970424 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1064776585 10:18785276-18785298 CTCTGTGTTTGGAGTGGGAATGG - Intergenic
1065058726 10:21875049-21875071 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1065645584 10:27830723-27830745 CTCTGGGTTGGTCCTGGAAAAGG - Intronic
1066460176 10:35606215-35606237 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1067003950 10:42643604-42643626 TTCTGTATTTGTAGTAGAGATGG + Intergenic
1067384953 10:45810512-45810534 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1069382009 10:67850902-67850924 CTTTGTATTTTTAGTGGAGACGG - Intergenic
1069402435 10:68063378-68063400 TTCTGGTTTTTTAGTAGAGACGG + Intronic
1070414162 10:76173830-76173852 TTTTGGATTTTTAGTGGAGATGG + Intronic
1070837264 10:79457227-79457249 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1070964110 10:80519046-80519068 CCCTGGGCTTGCAGTGGGGAGGG - Exonic
1071203747 10:83251090-83251112 ATTTGGGTTTGTAGGGGACAAGG + Intergenic
1071968436 10:90877139-90877161 TTTTGGGTTTTTAGTAGAGATGG - Intronic
1072119147 10:92390847-92390869 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1072157090 10:92733636-92733658 CTCTTGGTTTATGCTGGAGAGGG - Intergenic
1072687592 10:97547733-97547755 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073200696 10:101732800-101732822 CCCAGGGTTTGAAGTGGGGAGGG - Intergenic
1073224763 10:101908831-101908853 TTCTGTGTTTTTAGTAGAGAAGG + Intronic
1073289541 10:102406677-102406699 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1073973821 10:109076399-109076421 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1074010456 10:109473593-109473615 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1074126831 10:110535272-110535294 CTTTGTATTTTTAGTGGAGACGG + Intergenic
1074324798 10:112439458-112439480 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1075231396 10:120682158-120682180 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1075327597 10:121547052-121547074 CTTTGTATTTTTAGTGGAGATGG - Intronic
1075334921 10:121601751-121601773 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1075609543 10:123841283-123841305 CTCAGGGCTGGTTGTGGAGACGG - Intronic
1075678780 10:124317500-124317522 ATCTGTGTTTGTAGCAGAGAGGG + Intergenic
1075767400 10:124904515-124904537 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1075843250 10:125522653-125522675 TTCTAGGTTTCTAGTGGTGAAGG + Intergenic
1075906542 10:126086503-126086525 CTTTGTATTTTTAGTGGAGATGG - Intronic
1075953893 10:126505782-126505804 TTCTGTATTTTTAGTGGAGACGG - Intronic
1076454264 10:130578562-130578584 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1076473649 10:130737456-130737478 ATGAGGGTTTCTAGTGGAGAGGG + Intergenic
1076661874 10:132060847-132060869 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1076727366 10:132419862-132419884 CCCAGGGTTTGTCGTGGAGAGGG + Intergenic
1077001158 11:323138-323160 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1077097997 11:807603-807625 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1077826621 11:5816708-5816730 CTTTGTATTTTTAGTGGAGACGG + Intronic
1078570438 11:12453118-12453140 CTCTGGGGTTTGAGTTGAGATGG + Intronic
1078744244 11:14096196-14096218 GTATGGGTTGGGAGTGGAGAAGG + Intronic
1079055287 11:17201033-17201055 TTTTGGGTTTTTAGTAGAGACGG - Intronic
1079194279 11:18311679-18311701 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1079223276 11:18583387-18583409 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1079291642 11:19193527-19193549 CTCTGTATTTTTAGTAGAGACGG + Intronic
1079297646 11:19247544-19247566 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1079467311 11:20743181-20743203 CTTTGTATTTTTAGTGGAGATGG - Intronic
1079685941 11:23360241-23360263 TTCTGAGTTTTTAGTAGAGATGG + Intergenic
1080007455 11:27424916-27424938 CTTTGTATTTGTAGTAGAGACGG + Intronic
1080121884 11:28687199-28687221 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1081196042 11:40161873-40161895 GTCTGTGTGTGTAGTTGAGAAGG + Intronic
1081557026 11:44173738-44173760 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1081580922 11:44351194-44351216 CTTTGTGTTTGAAGTGGAAATGG - Intergenic
1082022885 11:47549985-47550007 TTCTGTATTTTTAGTGGAGATGG + Intronic
1082061720 11:47866787-47866809 TTCTGTATTTGTAGTAGAGACGG - Intergenic
1082762025 11:57136589-57136611 TTTTGTGTTTCTAGTGGAGATGG - Intergenic
1082873509 11:57965507-57965529 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1083021126 11:59508458-59508480 GTCTGTGTTTTTAGTAGAGATGG - Intergenic
1083032388 11:59604979-59605001 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1083295328 11:61712307-61712329 CCCTGGGGTTGTAGTGAGGATGG + Intronic
1083599512 11:63938332-63938354 CTCAGGGTTTAGAGGGGAGACGG - Intergenic
1083666780 11:64279593-64279615 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1084645504 11:70455050-70455072 GTGTGTTTTTGTAGTGGAGACGG + Intergenic
1084742347 11:71147817-71147839 CTCTGTGTTTGAAGCAGAGAGGG - Intronic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1085466917 11:76730311-76730333 CTCTGGGTTTCCAGTGGGGGAGG - Intergenic
1085787982 11:79471788-79471810 CTCTGGCCTTGTTGTGGAGTGGG + Intergenic
1085989777 11:81827895-81827917 CTCTGTATTTTTAGTGGAGACGG + Intergenic
1086093814 11:83030625-83030647 CTTTTGTTTTTTAGTGGAGATGG - Intronic
1086246166 11:84755593-84755615 CTTTGTATTTTTAGTGGAGACGG + Intronic
1086898640 11:92341276-92341298 CTCGGGCTCTTTAGTGGAGATGG + Intergenic
1087426462 11:97993203-97993225 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1087770047 11:102199022-102199044 CTATGTGTTTGTGGAGGAGAAGG + Intronic
1087778766 11:102281658-102281680 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1088028731 11:105219772-105219794 GTCTGTATTTATAGTGGAGACGG - Intergenic
1088413751 11:109567046-109567068 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1089453970 11:118615022-118615044 TTTTGTATTTGTAGTGGAGATGG - Intronic
1089515272 11:119028093-119028115 CTCTGGGTTGGGTGTGGAGGTGG + Intronic
1089850519 11:121492188-121492210 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1090067621 11:123517088-123517110 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1090800323 11:130167038-130167060 TTTTGGATTTTTAGTGGAGATGG - Intronic
1091241939 11:134058854-134058876 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1091564442 12:1638074-1638096 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1092176671 12:6413130-6413152 TTTTGTGTTTGTAGTAGAGACGG - Intergenic
1092232099 12:6781796-6781818 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1092558990 12:9589656-9589678 TTCTGTGTTTCTAGTGGAGATGG - Intergenic
1092799993 12:12155023-12155045 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1092823566 12:12375973-12375995 TTCTGTATTTTTAGTGGAGATGG + Intronic
1093037367 12:14345403-14345425 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1093127529 12:15348584-15348606 CACTGTGTTTTTAGTAGAGACGG - Intronic
1093554393 12:20453348-20453370 GTGTGTGTTTTTAGTGGAGATGG + Intronic
1093564825 12:20589694-20589716 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1093686265 12:22057995-22058017 ATTTGTGTTTTTAGTGGAGATGG + Intronic
1094465304 12:30747505-30747527 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1094679485 12:32655415-32655437 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1094820862 12:34223128-34223150 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1095051300 12:37557040-37557062 CTTTGTCTTTTTAGTGGAGATGG + Intergenic
1095782755 12:46078260-46078282 CTCTGGGCTTGTAATGGAAGGGG + Intergenic
1096151260 12:49314501-49314523 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1096288186 12:50318371-50318393 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1096372329 12:51079589-51079611 TTTTGGATTTTTAGTGGAGATGG - Intronic
1096386078 12:51196217-51196239 ATCTGGGTTTGGGGTGGAGCTGG - Intronic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1096624007 12:52882161-52882183 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1096828498 12:54297182-54297204 TTCTGCATTTTTAGTGGAGATGG - Intronic
1096869691 12:54585541-54585563 CTCTAGGTTAGCAGTGGGGAGGG + Intronic
1096987725 12:55772480-55772502 CTCTGGGGTTGAAGAGGAGTGGG - Intronic
1097043170 12:56168542-56168564 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1097740249 12:63233562-63233584 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1098137421 12:67417294-67417316 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1098346006 12:69504031-69504053 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1098439925 12:70506381-70506403 TTTTGCGTTTTTAGTGGAGATGG - Intergenic
1098941397 12:76541305-76541327 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1099468055 12:83011003-83011025 TTTTGGGTTTTTAGTAGAGATGG + Intronic
1099676165 12:85763048-85763070 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1100126540 12:91433672-91433694 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1100508698 12:95246291-95246313 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1101046774 12:100814788-100814810 CACTTGGTTTGAAGTGAAGATGG - Intronic
1101207801 12:102506271-102506293 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1101981835 12:109414303-109414325 TTTTGGATTTTTAGTGGAGATGG - Intronic
1102209534 12:111115455-111115477 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1102289748 12:111689545-111689567 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1102302136 12:111778659-111778681 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1102332667 12:112048015-112048037 CTCTTGATTTGTAGGGGAGGCGG + Intronic
1102398290 12:112606549-112606571 TTTTGGATTTTTAGTGGAGATGG + Intronic
1102873626 12:116432986-116433008 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1103519483 12:121528386-121528408 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1103603818 12:122071961-122071983 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1103630538 12:122256401-122256423 TTTTGTATTTGTAGTGGAGATGG - Intronic
1103756176 12:123209101-123209123 TTTTGGGTTTTTAGTAGAGATGG + Intronic
1103776624 12:123371158-123371180 GTGTGGGTTTTTAGTAGAGACGG - Intergenic
1104059401 12:125254853-125254875 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1105058788 12:133129329-133129351 TTCTGTATTTTTAGTGGAGATGG - Intronic
1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG + Intergenic
1106038890 13:26070798-26070820 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1106604536 13:31215582-31215604 TTTTGCGTTTTTAGTGGAGACGG + Intronic
1107050705 13:36045679-36045701 CTTTGTGTTTTTAGTGGATATGG - Intronic
1107114859 13:36735565-36735587 CTTTGTGTTTGTAGTACAGAGGG + Intergenic
1107340470 13:39399921-39399943 CTTTGTGTTTTTAGTAGAGACGG - Intronic
1107464012 13:40632465-40632487 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1107766365 13:43739375-43739397 CTTTGCGTTTTTAGTAGAGATGG - Intronic
1107946469 13:45421206-45421228 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1108119315 13:47166008-47166030 CTTTGTATTTTTAGTGGAGATGG - Intergenic
1108336407 13:49445756-49445778 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1108683835 13:52802279-52802301 CTTTGTATTTTTAGTGGAGACGG + Intergenic
1109154511 13:58889751-58889773 CCCGGTGGTTGTAGTGGAGAGGG + Intergenic
1109569406 13:64166493-64166515 CTCTGGGTTTGTAAATGAGGCGG + Intergenic
1109581645 13:64347040-64347062 TTCTGTGTTTGTAGTAGAGACGG - Intergenic
1109830779 13:67784574-67784596 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1109991945 13:70069994-70070016 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1110080449 13:71303558-71303580 GTGTGTGTTTGTAGTAGAGATGG - Intergenic
1110107791 13:71700383-71700405 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1110256106 13:73435652-73435674 CACTGGGCTTATAGTGAAGAGGG - Intergenic
1110815871 13:79859357-79859379 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1111566021 13:90017219-90017241 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1111756200 13:92398835-92398857 TTCTGGGTATGTAGTCAAGAAGG - Intronic
1111885320 13:94013518-94013540 TTTTGTATTTGTAGTGGAGACGG + Intronic
1112057577 13:95705020-95705042 CTCTGTATTTTTAGTAGAGATGG + Intronic
1112331084 13:98477500-98477522 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1112514120 13:100037246-100037268 TTGTGTGTTTTTAGTGGAGACGG + Intergenic
1113326676 13:109289032-109289054 CTTTGTATTTTTAGTGGAGATGG - Intergenic
1113732683 13:112653278-112653300 CTCTGCGTTTGTAATGGAAAGGG - Intronic
1115010796 14:28542280-28542302 CTCTGCCTTTGTAGTGTAAAAGG - Intergenic
1115337166 14:32253525-32253547 TTTTGTGTTTGTAGTAGAGACGG - Intergenic
1115592262 14:34875167-34875189 CGTTGCCTTTGTAGTGGAGAAGG - Exonic
1115686508 14:35802135-35802157 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1116023247 14:39486394-39486416 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1116637581 14:47416887-47416909 CTCTGGGTTTGTAATGGAAAGGG + Intronic
1116952375 14:50891413-50891435 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1117364835 14:55015867-55015889 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1117887415 14:60379980-60380002 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1117916761 14:60685825-60685847 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1118016904 14:61670020-61670042 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1118028153 14:61791676-61791698 TTCTGTATTTGTAGTAGAGATGG - Intronic
1118115705 14:62774218-62774240 TTCTGGTTTTGTACTGGAGATGG + Intronic
1118358027 14:65031486-65031508 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1118431165 14:65720239-65720261 CTGTGGGCTTGTAGTGGTGGTGG - Intronic
1118860631 14:69660317-69660339 CTATATGTTGGTAGTGGAGAAGG - Intronic
1118898293 14:69965205-69965227 TTGTGTGTTTTTAGTGGAGATGG - Intronic
1119050942 14:71367775-71367797 TTTTGGGTTTTTAGTAGAGACGG + Intronic
1119073235 14:71608722-71608744 CTCTGTATTTTTAGTAGAGACGG - Intronic
1119310487 14:73642361-73642383 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1119369013 14:74121891-74121913 TTTTGGATTTTTAGTGGAGACGG + Intronic
1119683408 14:76610393-76610415 CTTTGTATTTGTAGTAGAGATGG + Intergenic
1120189264 14:81425400-81425422 TTTTGTGTTGGTAGTGGAGATGG - Intronic
1120374083 14:83678114-83678136 CTGTGTGTTTTTAGTAGAGACGG - Intergenic
1120454937 14:84718750-84718772 GTCTGGGGTTGGAGTAGAGAGGG - Intergenic
1120540776 14:85747828-85747850 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1120542196 14:85764202-85764224 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1120789487 14:88566048-88566070 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1121558416 14:94856030-94856052 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1121712416 14:96048694-96048716 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1122095362 14:99366566-99366588 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1122249609 14:100428525-100428547 CTCTGCGTTCTTAGTGGAGGTGG + Intronic
1122268683 14:100558620-100558642 CTGTGGATTTGTAGGGGCGATGG - Intronic
1122296789 14:100710313-100710335 TTTTGGGTTTTTAGTAGAGACGG + Intergenic
1122667616 14:103343988-103344010 CTCTGGCTTTGTAGTAGTCAGGG - Exonic
1122678789 14:103439953-103439975 CTTTGTGTTTTTAGTAGAGACGG + Intronic
1122713452 14:103678102-103678124 CACTGTGTTTTTAGTAGAGATGG - Intronic
1123173009 14:106391585-106391607 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1123771267 15:23531772-23531794 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1123925029 15:25100102-25100124 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1124892678 15:33747593-33747615 TTTTGAGTTTTTAGTGGAGATGG + Intronic
1124951203 15:34322805-34322827 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1125120067 15:36145699-36145721 TTCTGGGAATATAGTGGAGAAGG + Intergenic
1125617972 15:41032865-41032887 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1125824765 15:42666983-42667005 TTCTGCGTTTTTAGTAGAGACGG + Intronic
1125909823 15:43426267-43426289 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1126838001 15:52687231-52687253 TTTTGTATTTGTAGTGGAGATGG - Intronic
1127289770 15:57559837-57559859 CTCTGGGTCTGTTGGGGGGATGG + Intergenic
1127438485 15:58982486-58982508 CTTTGTGTTTTTAGTAGAGACGG + Intronic
1127455037 15:59149226-59149248 GTTTGTGTTTTTAGTGGAGACGG + Intronic
1127516352 15:59696849-59696871 GTGTGTGTTTTTAGTGGAGATGG - Intergenic
1128235442 15:66064195-66064217 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1128287255 15:66447518-66447540 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1128505402 15:68267368-68267390 TTCTGTATTTGTAGTAGAGATGG + Intergenic
1128903934 15:71451005-71451027 CTCTGCATTTTTAGTGGAGACGG - Intronic
1129435872 15:75539839-75539861 CTTTGTATTTTTAGTGGAGACGG + Intronic
1129487142 15:75885286-75885308 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1129543523 15:76371488-76371510 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1130111578 15:80969682-80969704 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1131573147 15:93559586-93559608 CTCTGGGTTTGCAATAGATAAGG + Intergenic
1132039897 15:98516277-98516299 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1132095485 15:98981318-98981340 CTTTGTATTTTTAGTGGAGACGG - Intronic
1132535867 16:480114-480136 TTTTGGGTTTTTAGTAGAGATGG - Intronic
1132987275 16:2774057-2774079 CTTTGTGTTTTTAGTAGAGATGG - Intronic
1133300041 16:4776812-4776834 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1133311894 16:4853730-4853752 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1133436831 16:5786963-5786985 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1133453633 16:5923709-5923731 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1133587605 16:7211217-7211239 CTTTGTGTTTTTAGTAGAGACGG - Intronic
1133672908 16:8041470-8041492 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1133809485 16:9150054-9150076 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1133941449 16:10312498-10312520 TTTTGGATTTTTAGTGGAGATGG - Intergenic
1133942834 16:10324702-10324724 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1133958187 16:10465565-10465587 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1134110952 16:11515273-11515295 TTCTGGATTTTTAGTAGAGATGG - Intronic
1134271142 16:12734549-12734571 TTCTGGATTTTTAGTAGAGACGG + Intronic
1134398243 16:13885128-13885150 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1134837821 16:17376654-17376676 ATTTGTGTTTTTAGTGGAGACGG - Intronic
1135015452 16:18920965-18920987 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1135031666 16:19043740-19043762 TTTTGTATTTGTAGTGGAGACGG + Intronic
1135271762 16:21075740-21075762 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1135321073 16:21496785-21496807 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1135373907 16:21928287-21928309 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1135437879 16:22442434-22442456 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1135450335 16:22551884-22551906 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1135771860 16:25223995-25224017 TTTTGTATTTGTAGTGGAGATGG + Intronic
1135919086 16:26632025-26632047 CTCTGGGTCTGTAATGGAAGGGG + Intergenic
1136379241 16:29884419-29884441 TTTTGGGTTTTTAGTAGAGACGG - Intronic
1136483914 16:30558935-30558957 TTGTGTGTTTTTAGTGGAGACGG - Intergenic
1136505796 16:30702402-30702424 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1136521410 16:30798672-30798694 TTCTGCGTTTTTAGTAGAGATGG + Intergenic
1136649216 16:31652004-31652026 CTCTGGACTTCTAGTAGAGACGG - Intergenic
1136711298 16:32239415-32239437 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1136756609 16:32689992-32690014 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1136811501 16:33180383-33180405 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1136817977 16:33290463-33290485 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1136824541 16:33346992-33347014 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1136829607 16:33445763-33445785 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1137489697 16:48921575-48921597 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1138034839 16:53593818-53593840 CTTTGTATTTTTAGTGGAGATGG + Intergenic
1138136552 16:54528369-54528391 CTCTGGGTTTTTAGTCCATATGG - Intergenic
1138565352 16:57828780-57828802 GGCTGGGCTTGTAGTGGAGAGGG - Intronic
1138566518 16:57837295-57837317 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1138704263 16:58898316-58898338 TTCTGAATTTTTAGTGGAGATGG + Intergenic
1139342618 16:66278346-66278368 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139538735 16:67597507-67597529 TTCTGTATTTTTAGTGGAGACGG + Intronic
1139689728 16:68632897-68632919 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1140640071 16:76961116-76961138 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1141045145 16:80709209-80709231 TTTTGTATTTGTAGTGGAGACGG - Intronic
1141086345 16:81098163-81098185 CTTTGGATTTGTAGTAGAGACGG - Intergenic
1141106631 16:81239185-81239207 CTGTGTGTTTTTAGTAGAGACGG + Intronic
1141143649 16:81514196-81514218 ATCTGGTTTTGTGGTGAAGAGGG + Intronic
1141250453 16:82352036-82352058 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1141501476 16:84447427-84447449 CTCTGGGTGGGTGGTGGGGAGGG - Intronic
1141750752 16:85956337-85956359 CCCTGTGGTTGTAGTGGAGTGGG - Intergenic
1141861821 16:86722320-86722342 TTCTGGATTTTTAGTAGAGATGG - Intergenic
1141895811 16:86958005-86958027 GTCTGTGTTTACAGTGGAGATGG - Intergenic
1142019437 16:87771888-87771910 TTTTGTGTTTGTAGTAGAGACGG - Intergenic
1142298795 16:89244248-89244270 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1202990079 16_KI270728v1_random:3352-3374 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1203058758 16_KI270728v1_random:950344-950366 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1142753325 17:2001247-2001269 CTCTGGGTTTTTTTTTGAGATGG + Intronic
1142847999 17:2691389-2691411 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1143024302 17:3932312-3932334 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1143220565 17:5257907-5257929 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1143454206 17:7055474-7055496 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1144087229 17:11821752-11821774 CCCTGGGTTTGGAGTAGACATGG + Intronic
1144137253 17:12308494-12308516 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1144465584 17:15494187-15494209 CTCTGTATTTTTAGTAGAGATGG - Intronic
1144545191 17:16188437-16188459 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1144809878 17:17992102-17992124 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1144997043 17:19277228-19277250 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1145016127 17:19399491-19399513 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1145375290 17:22342055-22342077 CTTTGTTTTTTTAGTGGAGATGG + Intergenic
1145954152 17:28842904-28842926 CCCTGGGTCTCTAGTGGACATGG + Intronic
1147405365 17:40207851-40207873 TTCTGGATTTTTAGTAGAGACGG + Intergenic
1147414729 17:40280296-40280318 TTTTGTGTTTTTAGTGGAGACGG - Exonic
1147465299 17:40606295-40606317 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1147802430 17:43102241-43102263 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1148158866 17:45438725-45438747 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1148432838 17:47656373-47656395 TTTTGGGTTTTTAGTAGAGATGG - Intronic
1148634599 17:49138704-49138726 CTTTGTATTTTTAGTGGAGACGG - Intronic
1149460983 17:56830169-56830191 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1149606995 17:57932099-57932121 GTGTGTGTTTTTAGTGGAGACGG - Intronic
1149800228 17:59560751-59560773 TTCTGGTTTTTTAATGGAGAAGG + Intergenic
1149935087 17:60797064-60797086 CTCTGTATTTTTAGTAGAGATGG + Intronic
1150055743 17:62013866-62013888 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1150313003 17:64144983-64145005 CTATGGGTTTGTAGTTGAATGGG - Intergenic
1150390220 17:64785807-64785829 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1151274762 17:73025945-73025967 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1151282391 17:73086647-73086669 TTTTGTATTTGTAGTGGAGATGG - Intronic
1151299409 17:73211687-73211709 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1151311327 17:73294178-73294200 TTCTGTGTTTTTAGTGGAGATGG - Intronic
1151367670 17:73627875-73627897 TTTTGTATTTGTAGTGGAGACGG - Intronic
1151592864 17:75058014-75058036 TTTTGGATTTTTAGTGGAGACGG - Intronic
1151617340 17:75222213-75222235 TTTTGTATTTGTAGTGGAGACGG + Intronic
1151677797 17:75608287-75608309 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1151762534 17:76114068-76114090 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1151907554 17:77058645-77058667 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1151930116 17:77227057-77227079 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153288043 18:3474628-3474650 TTTTGCGTTTTTAGTGGAGACGG + Intergenic
1153481799 18:5554637-5554659 CTCTGGGTGTGTGGTGGAAGAGG - Intronic
1153822000 18:8839989-8840011 CTCTGTCTTTGAAGTGGAGTGGG - Intergenic
1153913368 18:9723216-9723238 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1154084456 18:11289630-11289652 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1154938953 18:21091797-21091819 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1155002256 18:21698749-21698771 CTCTGTATTTTTAGTGTAGATGG + Intronic
1155134450 18:22974628-22974650 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1155285623 18:24285984-24286006 TTTTGTATTTGTAGTGGAGATGG - Intronic
1155551697 18:26972184-26972206 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1155772550 18:29720331-29720353 CTCTGGTTTTGTAGATGAGAGGG - Intergenic
1155937021 18:31764712-31764734 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1156951511 18:42905641-42905663 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1157229284 18:45898952-45898974 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1157233147 18:45938288-45938310 TTTTGGGTTTGTAGTAGAGACGG - Intronic
1157343501 18:46802381-46802403 TTCTGTGTTTTTAGTAGAGAAGG - Intergenic
1157885252 18:51360320-51360342 CTTTGTATTTTTAGTGGAGACGG + Intergenic
1158089319 18:53692318-53692340 TTCTGGATTTTTAGTAGAGATGG - Intergenic
1158384389 18:56973036-56973058 CTTTGTATTTTTAGTGGAGACGG + Intronic
1158390227 18:57039067-57039089 TGCTGGGATTGTAGTGGGGAAGG + Intergenic
1158454932 18:57597669-57597691 ATTTGTGTTTTTAGTGGAGACGG - Intergenic
1158753480 18:60294204-60294226 TTTTGGATTTTTAGTGGAGACGG + Intergenic
1159252306 18:65895527-65895549 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1160440286 18:78884334-78884356 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1160885700 19:1346498-1346520 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1161259159 19:3326764-3326786 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1161317753 19:3626188-3626210 TTCTGGCTTTGAGGTGGAGAAGG - Intronic
1161374969 19:3934749-3934771 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1161568239 19:5015420-5015442 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1161667636 19:5586680-5586702 CTCTGCGTGGGTAGTGGTGAGGG - Intergenic
1161854991 19:6759281-6759303 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1162122551 19:8480492-8480514 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1162256760 19:9496763-9496785 TTTTGTATTTGTAGTGGAGATGG - Intronic
1162662045 19:12177517-12177539 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1162754815 19:12851654-12851676 TTTTGCGTTTTTAGTGGAGATGG + Intronic
1162841609 19:13360646-13360668 CTTTGTATTTTTAGTGGAGATGG + Intronic
1162892040 19:13740705-13740727 CTTTGTATTTTTAGTGGAGATGG + Intronic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1163318360 19:16556797-16556819 CTCTTGGAGTGCAGTGGAGATGG - Intronic
1163334865 19:16664243-16664265 TTTTGCATTTGTAGTGGAGACGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163527868 19:17832089-17832111 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1163684805 19:18705486-18705508 CTTTGTGTTTTTAATGGAGATGG + Intronic
1163816792 19:19471083-19471105 TTCTGTATTTTTAGTGGAGACGG - Intronic
1163820372 19:19493109-19493131 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1163824798 19:19516955-19516977 CTTTGTGTTTTTAGTAGAGACGG + Intronic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163873560 19:19846240-19846262 CTCTGAATTGGTAGTGGAGAGGG - Intergenic
1163882249 19:19935347-19935369 CTCTGAATTTGTAGTGATGAGGG - Exonic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163936755 19:20453357-20453379 ATCTGAATTTGTAGTGAAGAGGG + Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164014690 19:21242954-21242976 CTCTGGGTTTGTAGTGGAGTTGG - Intronic
1164031276 19:21408001-21408023 CTCTGGGTTTGTAGTGGAGTGGG + Intronic
1164031310 19:21408297-21408319 TTGTGTGTTTTTAGTGGAGACGG + Intronic
1164045127 19:21531303-21531325 CTATGGATTTGTAATAGAGAGGG - Intronic
1164102938 19:22075081-22075103 CTCTGGGTTTGTGATGGAGAGGG + Intronic
1164113359 19:22191790-22191812 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164197755 19:22986086-22986108 CTCTGGGTTTGTAGTAGAGTGGG - Intronic
1164215071 19:23137758-23137780 CTCTGGGCTTATAGTGGAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164373113 19:27658604-27658626 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1164424160 19:28125444-28125466 CTCTGAGTTTCTGCTGGAGAAGG + Intergenic
1165477033 19:36036768-36036790 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1165541390 19:36494848-36494870 TTTTGGGTTTCTAGTAGAGACGG + Intergenic
1165572875 19:36790396-36790418 CTTTGTCTTTTTAGTGGAGATGG - Intergenic
1165683409 19:37796954-37796976 CATTGTATTTGTAGTGGAGACGG + Intronic
1165683827 19:37800555-37800577 CTTTGTCTTTTTAGTGGAGATGG - Intronic
1165698952 19:37922563-37922585 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1166062603 19:40336061-40336083 CTCTGGGTTTGGCATGGAGGTGG - Intronic
1166367825 19:42286179-42286201 CTCTGTGTTTGTGGTGGGGGAGG + Intronic
1166388247 19:42394224-42394246 GTGTGCGTTTTTAGTGGAGACGG - Intergenic
1166559584 19:43723266-43723288 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1166710832 19:44936121-44936143 CTCTTGGATTTTGGTGGAGAGGG + Intergenic
1166973973 19:46592590-46592612 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1167055091 19:47105428-47105450 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1167068164 19:47202739-47202761 CTCTGAATTTTTAGTAGAGACGG - Intronic
1167088597 19:47327862-47327884 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1167106847 19:47435417-47435439 CTCTGGGGACTTAGTGGAGACGG - Intronic
1167205719 19:48100344-48100366 TTCTGTATTTTTAGTGGAGACGG - Intronic
1167335271 19:48881553-48881575 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1167349922 19:48968199-48968221 CGCTTGGTTTGCAGTTGAGAGGG - Exonic
1167431996 19:49460582-49460604 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1167446732 19:49542493-49542515 CTCTGGGGGTCTAGTGGAGCTGG - Intronic
1167511455 19:49897331-49897353 CTCTGGGTGGCAAGTGGAGAGGG - Intronic
1167617841 19:50545892-50545914 TTTTGGTTTTTTAGTGGAGATGG + Intronic
1167933389 19:52886763-52886785 CTTTGTGTTTTTAGTAGAGATGG - Intronic
1167936620 19:52913953-52913975 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1168029771 19:53670232-53670254 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1168141931 19:54393886-54393908 CTGTGTGTTTTTAGTAGAGACGG - Intergenic
1168165156 19:54542182-54542204 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1168341961 19:55629618-55629640 TTTTGTATTTGTAGTGGAGACGG - Intergenic
1168618829 19:57860437-57860459 TTTTGTGTTTTTAGTGGAGATGG + Exonic
925214704 2:2084496-2084518 CCCTGGGCTAGGAGTGGAGAGGG + Intronic
925573558 2:5336708-5336730 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
926052097 2:9751849-9751871 CTATGGGTTTCTAGTGGATTGGG + Intergenic
926445831 2:12941983-12942005 TTCTGTATTTTTAGTGGAGATGG - Intergenic
926710855 2:15879155-15879177 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
926755985 2:16236383-16236405 CTCTTAGGTTGCAGTGGAGAGGG - Intergenic
927615871 2:24594585-24594607 CTTTTGGTTTGTTGTGCAGATGG + Intronic
927775884 2:25902817-25902839 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
927796713 2:26055693-26055715 TTTTGTGTTTGTAGTAGAGATGG + Intronic
928017625 2:27673043-27673065 CTCTGGATTTCTACTGCAGATGG + Intronic
928140949 2:28728456-28728478 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
928516535 2:32049808-32049830 TTCTGTATTTTTAGTGGAGACGG + Intergenic
928851610 2:35754163-35754185 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
929059296 2:37906777-37906799 TTTTGGATTTTTAGTGGAGATGG - Intergenic
929173592 2:38955845-38955867 TTTTGTGTTTTTAGTGGAGATGG + Intronic
929183596 2:39069716-39069738 TTCTGTATTTTTAGTGGAGACGG + Intronic
929194463 2:39171066-39171088 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
929205233 2:39284329-39284351 TTCTGTATTTGTAGTAGAGATGG + Intronic
929298747 2:40277367-40277389 TTTTGTGTTTTTAGTGGAGACGG - Intronic
929305975 2:40362063-40362085 CTCTGTATTTTTAGTAGAGATGG + Intronic
929744117 2:44637892-44637914 TTTTGTATTTGTAGTGGAGATGG - Intronic
929820055 2:45266006-45266028 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
929892888 2:45933646-45933668 TTTTGTGTTTTTAGTGGAGACGG + Intronic
929997585 2:46838476-46838498 TTTTGTGTTTTTAGTGGAGATGG + Intronic
930875654 2:56212467-56212489 CTTTGGCTTTGTAGTTGACAGGG + Intronic
931262095 2:60629329-60629351 CTCTAGGTTTCTAGAAGAGAAGG + Intergenic
931435473 2:62242053-62242075 TTTTGTATTTGTAGTGGAGACGG - Intergenic
931519008 2:63074654-63074676 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
931623753 2:64236548-64236570 TTCTGTATTTTTAGTGGAGATGG - Intergenic
931678367 2:64720758-64720780 CTCTGGTTTTGTGATGCAGACGG - Intronic
932183917 2:69675092-69675114 TTCTGTATTTGTAGTAGAGACGG + Intronic
932500794 2:72181035-72181057 TTCTGGATTTTTAGTAGAGATGG - Intronic
932682365 2:73836820-73836842 CCCAGGGGTTGAAGTGGAGATGG - Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932915185 2:75850244-75850266 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
933188073 2:79301246-79301268 CTCTGCCTTCGTAGTGTAGAAGG - Intronic
933651248 2:84852089-84852111 CTCTGGTTATGTTGTGGGGAGGG + Intronic
934715523 2:96540913-96540935 TTTTGTATTTGTAGTGGAGATGG + Intronic
934741523 2:96726911-96726933 TTTTGTGTTTTTAGTGGAGACGG - Intronic
934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG + Intronic
934979985 2:98831762-98831784 CTCTTGGATTCTAATGGAGAAGG + Intronic
935051240 2:99526770-99526792 TTTTGTGTTTGTAGTAGAGACGG + Intergenic
935118794 2:100161579-100161601 TTCTGTATTTTTAGTGGAGATGG - Intergenic
935158873 2:100511632-100511654 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
935165440 2:100565136-100565158 TTTTGTGTTTTTAGTGGAGATGG + Intronic
935369724 2:102332638-102332660 CTATGGGTTTGTGGTGGAAGAGG + Intronic
935449481 2:103192193-103192215 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
935796157 2:106643310-106643332 TTCTGAGTTTTTAGTAGAGACGG + Intergenic
936086189 2:109471047-109471069 TTTTGTGTTTTTAGTGGAGATGG - Intronic
936107990 2:109641974-109641996 TTTTGGGTTTTTAGTAGAGACGG + Intergenic
936133020 2:109863539-109863561 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
936211677 2:110507946-110507968 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
936420816 2:112362523-112362545 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
936577114 2:113666404-113666426 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
936824457 2:116564107-116564129 CTCTGAGCTTGTAGCTGAGATGG + Intergenic
937123591 2:119458427-119458449 TTTTGTGTTTTTAGTGGAGACGG - Intronic
937374280 2:121324758-121324780 CTTTGTATTTTTAGTGGAGACGG - Intergenic
937416079 2:121715620-121715642 CTCTGTATTTTTAGTAGAGACGG - Intergenic
937531611 2:122835872-122835894 TTTTGGGTTTTTAGTTGAGATGG + Intergenic
938469655 2:131546765-131546787 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
938861611 2:135375380-135375402 CTTTGTGTTTTTAGTAGAGATGG - Intronic
938887837 2:135671537-135671559 TTTTGTATTTGTAGTGGAGATGG + Intronic
938950076 2:136247198-136247220 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
939024111 2:136991491-136991513 ACCTGGGTATGCAGTGGAGAGGG + Intronic
939615482 2:144357469-144357491 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
940104567 2:150083793-150083815 TTTTGGGTTTTTAGTAGAGACGG - Intergenic
940841962 2:158594151-158594173 GGTTGGGTTTGGAGTGGAGATGG + Intronic
940917784 2:159276230-159276252 TTCTGTGTTTTTAGTAGAGACGG + Intronic
941154033 2:161953435-161953457 CTTTGTGTTTTTAGTAGAGATGG - Intronic
941184888 2:162309382-162309404 CTCTGGGTCTGTGGTGGAAGTGG + Intronic
941223592 2:162816085-162816107 TTTTGGGTTTTTAGTAGAGATGG - Intronic
941515116 2:166463883-166463905 TTTTGTGTTTGTAGTAGAGATGG - Intronic
941760738 2:169239999-169240021 CTATTGGGTTGTAGTGAAGAAGG - Intronic
941797390 2:169615217-169615239 TTCTGTATTTTTAGTGGAGATGG + Intronic
941806913 2:169718750-169718772 TTTTGCGTTTTTAGTGGAGACGG - Intronic
941882398 2:170494555-170494577 CTTTGTATTTTTAGTGGAGACGG - Intronic
941885654 2:170524652-170524674 TTTTGTGTTTTTAGTGGAGATGG + Intronic
941989003 2:171536474-171536496 TTTTGTGTTTTTAGTGGAGACGG + Intronic
942044634 2:172093001-172093023 CTAGGGGTTTGTTGTGGAGCTGG - Intergenic
942175388 2:173328897-173328919 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
942202588 2:173586535-173586557 CTTTGTATTTTTAGTGGAGATGG - Intergenic
942338474 2:174917019-174917041 CTTTGTGTTTTTAGTGGAGATGG - Intronic
942656388 2:178218492-178218514 TTCTGGGTTGGTAATGGAAATGG + Intronic
942723418 2:178980275-178980297 TTTTGGATTTGTAGTAGAGATGG - Intronic
942758464 2:179369726-179369748 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
943141870 2:183993056-183993078 GCCTTGGTTTGGAGTGGAGAAGG + Intergenic
943198566 2:184788963-184788985 CTGTGGGTTTGTCATAGAGATGG + Intronic
943284664 2:185982298-185982320 CTCTGGGTTTAAATTTGAGAAGG - Intergenic
943452802 2:188066165-188066187 TTTTGGATTTTTAGTGGAGACGG - Intergenic
943601497 2:189926456-189926478 TTTTGGGTTTTTAGTAGAGACGG + Intronic
944481863 2:200165403-200165425 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
944510568 2:200460982-200461004 TTTTGGGTTTTTAGTAGAGATGG + Intronic
944643316 2:201751021-201751043 TTCTGTGTTTTTAGTAGAGATGG + Intronic
944646122 2:201782416-201782438 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
944895784 2:204162899-204162921 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
945617853 2:212095758-212095780 TTCTGTGTTTTTAGTAGAGACGG - Intronic
945977538 2:216282469-216282491 CTCTGGGGTGGTGGTGGAGGGGG - Intronic
945980076 2:216302725-216302747 TTTTGTGTTTTTAGTGGAGACGG - Intronic
946275022 2:218624938-218624960 TTTTGTGTTTTTAGTGGAGATGG - Intronic
946426416 2:219600278-219600300 TTTTGTGTTTTTAGTGGAGACGG + Intronic
946462609 2:219882448-219882470 TTGTGTGTTTTTAGTGGAGACGG + Intergenic
946734698 2:222742754-222742776 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
946793047 2:223320825-223320847 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
946964484 2:225023204-225023226 TTTTGTGTTTTTAGTGGAGACGG + Intronic
947660565 2:231863392-231863414 TTTTGCGTTTGTAGTAGAGATGG + Intergenic
947770976 2:232669769-232669791 CTTTGTATTTTTAGTGGAGACGG + Intronic
947863055 2:233376154-233376176 CCTTTGGTGTGTAGTGGAGATGG + Intronic
948931263 2:241133810-241133832 TTTTGTGTTTTTAGTGGAGACGG - Intronic
948940493 2:241193238-241193260 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1168964701 20:1892417-1892439 ATCTGGGGTGGGAGTGGAGATGG - Intergenic
1169630504 20:7625852-7625874 CTCTGGGTCTGCTGTGGGGAGGG - Intergenic
1169873707 20:10273786-10273808 CTCTTGTCTTGTAGCGGAGATGG - Intronic
1169890875 20:10450922-10450944 TTTTGGGTTTTTAGTAGAGACGG + Intronic
1170377632 20:15718157-15718179 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1170470960 20:16667507-16667529 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1170905798 20:20514474-20514496 ATCTGGATGTGGAGTGGAGAGGG - Intronic
1171241432 20:23570177-23570199 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1171499679 20:25584300-25584322 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1171527010 20:25821654-25821676 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1171527631 20:25827661-25827683 CTTTGCTTTTTTAGTGGAGATGG - Intronic
1171541652 20:25962468-25962490 GTGTGTGTTTTTAGTGGAGACGG - Intergenic
1171545836 20:26000553-26000575 CTTTGTCTTTTTAGTGGAGATGG + Intergenic
1171549195 20:26028223-26028245 CTTTGCTTTTTTAGTGGAGATGG + Intergenic
1171549817 20:26034231-26034253 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1171799414 20:29597892-29597914 GTGTGTGTTTTTAGTGGAGACGG + Intergenic
1171844642 20:30258605-30258627 GTGTGTGTTTTTAGTGGAGACGG - Intergenic
1172170171 20:32925521-32925543 TTTTGGGTTTTTAGTGGAGACGG + Intronic
1172325054 20:34028113-34028135 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1172577995 20:36024163-36024185 TTTTGGGTTTTTAGTAGAGATGG - Intronic
1172716407 20:36967549-36967571 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1172896000 20:38300406-38300428 CTCTGGGTTTGGACTGGATAGGG - Intronic
1173113051 20:40213426-40213448 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1173258900 20:41415563-41415585 CTATGAGTTTGAGGTGGAGAGGG - Exonic
1173513149 20:43646034-43646056 TTTTGTATTTGTAGTGGAGACGG - Intronic
1173573588 20:44095231-44095253 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1173649362 20:44653161-44653183 TTTTGGATTTGTAGTAGAGACGG + Intergenic
1173959487 20:47059957-47059979 AACTGTGTTTGTAGTGTAGAGGG - Intronic
1174406779 20:50307992-50308014 TTTTGTATTTGTAGTGGAGACGG + Intergenic
1174454388 20:50639069-50639091 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1174472409 20:50770678-50770700 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1174589972 20:51637160-51637182 CTCTGGGATAGTAGTAGAAATGG - Intronic
1174623752 20:51897253-51897275 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1174743516 20:53039606-53039628 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1175120490 20:56712660-56712682 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1175910336 20:62402336-62402358 CTTTGGGTTTCTAATGGGGATGG - Intronic
1176170629 20:63694933-63694955 CTCTGGCTTTGCAGTGGTCAGGG - Exonic
1176337657 21:5613873-5613895 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1176383433 21:6125350-6125372 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1176471319 21:7109099-7109121 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1176494880 21:7490877-7490899 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1176505762 21:7647506-7647528 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1177073944 21:16548659-16548681 TTCTGTATTTTTAGTGGAGATGG + Intergenic
1177142074 21:17368338-17368360 CTCTGGGTTTTTTGTGGGGGCGG + Intergenic
1177345409 21:19862076-19862098 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1177627580 21:23683760-23683782 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1177920551 21:27147009-27147031 TTTTGTATTTGTAGTGGAGACGG + Intergenic
1177972533 21:27808361-27808383 TTCTGCATTTGTAGTAGAGACGG - Intergenic
1178272382 21:31203291-31203313 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1178291082 21:31369052-31369074 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1178317417 21:31578262-31578284 CTTTGCGTTTTTAGTAGAGATGG - Intergenic
1178586111 21:33872700-33872722 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1178670406 21:34585569-34585591 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1178777944 21:35570052-35570074 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1179301795 21:40118414-40118436 TTCTGTGGTTTTAGTGGAGATGG - Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179573951 21:42295148-42295170 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1179666263 21:42914696-42914718 TTTTGGGTTTTTAGTAGAGATGG - Intergenic
1179682585 21:43034659-43034681 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1180822227 22:18838436-18838458 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1180986757 22:19909032-19909054 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1181164616 22:20976688-20976710 CTCTGTGTCTGTGGTGGAGCTGG + Exonic
1181190745 22:21137610-21137632 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1181208460 22:21272897-21272919 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1181674589 22:24443512-24443534 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1181750211 22:24983946-24983968 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1181828702 22:25541167-25541189 CTCTGTCCTTTTAGTGGAGAGGG + Intergenic
1182209107 22:28659437-28659459 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1182309131 22:29392248-29392270 TTTTGTATTTGTAGTGGAGATGG + Intronic
1182359199 22:29736850-29736872 TTGTGTGTTTTTAGTGGAGACGG - Intronic
1182375349 22:29843251-29843273 CTTTGGATTTTTAGTAGAGACGG - Intergenic
1182441546 22:30367406-30367428 TTTTGGATTTTTAGTGGAGACGG + Intronic
1182938230 22:34247441-34247463 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1183342310 22:37288239-37288261 CTCTGTATTTTTAGTAGAGATGG - Intronic
1183557081 22:38537382-38537404 CTCTGTATTTTTAGTAGAGACGG + Intronic
1183726416 22:39592408-39592430 CTCTGGGCTTGCTGTGGAGCTGG + Intronic
1183882779 22:40849303-40849325 TTTTGTGTTTTTAGTGGAGAAGG - Intronic
1184129144 22:42507253-42507275 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1184139145 22:42567898-42567920 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1184222063 22:43107297-43107319 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1184274109 22:43400449-43400471 TTCTTGGTTTGTAATGGGGAGGG + Intergenic
1184278300 22:43423005-43423027 TTTTGTGTTTTTAGTGGAGAGGG + Intronic
1184346454 22:43916569-43916591 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
1184904699 22:47473041-47473063 CTCTGGGCTTGTGATGGACATGG + Intronic
1185252994 22:49815370-49815392 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1185423124 22:50746260-50746282 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1203218473 22_KI270731v1_random:22515-22537 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1203272361 22_KI270734v1_random:64321-64343 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
949645747 3:6091761-6091783 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
949726661 3:7055943-7055965 CACAGGGTTTGTAGAGGATATGG + Intronic
949850328 3:8413987-8414009 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
950071010 3:10152660-10152682 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
950085077 3:10251554-10251576 CTTTGTATTTTTAGTGGAGATGG + Intronic
950311976 3:11966778-11966800 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
950368159 3:12503934-12503956 CTCTGGGGTTTTAGTTGAAATGG - Intronic
950382116 3:12625251-12625273 TTTTGTGTTTTTAGTGGAGATGG + Intronic
950869404 3:16215737-16215759 TTCTGTATTTTTAGTGGAGACGG - Intronic
951409237 3:22342101-22342123 TTCTGTGTTTTTAGTAGAGACGG - Intronic
951880320 3:27474935-27474957 TTTTGTGTTTGTAGTAGAGATGG - Intronic
952222688 3:31340809-31340831 CTTTGGATTTTTAGTAGAGATGG - Intergenic
952320347 3:32271293-32271315 TTTTGTATTTGTAGTGGAGATGG + Intronic
952377904 3:32782274-32782296 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
952723783 3:36560696-36560718 CACTGTGTTTGTGGTGGAGGTGG - Intergenic
952811627 3:37409463-37409485 TTTTGTGTTTTTAGTGGAGATGG + Intronic
952819341 3:37472564-37472586 TTTTGTGTTTTTAGTGGAGACGG + Intronic
953071767 3:39527627-39527649 CTTTGTATTTTTAGTGGAGATGG + Intronic
953229914 3:41055417-41055439 TCCTGGGTTTGTAGAGGGGAAGG + Intergenic
953669556 3:44951318-44951340 CTCTGAGTTTTCAGTGCAGAAGG + Intronic
953750788 3:45606962-45606984 TTCTGTATTTTTAGTGGAGACGG + Intronic
953908368 3:46879866-46879888 TTTTGCATTTGTAGTGGAGATGG - Intronic
953935886 3:47042189-47042211 TTTTGTGTTTTTAGTGGAGACGG - Intronic
954086770 3:48250919-48250941 TTTTGTGTTTTTAGTGGAGACGG + Intronic
954094067 3:48309103-48309125 CTGTGAGTTTGTCATGGAGATGG + Intronic
954245597 3:49329005-49329027 TTTTGTGTTTGTAGTAGAGACGG - Intronic
954530370 3:51313700-51313722 CTCTAGGTTAGTGGTGGGGATGG - Intronic
954594345 3:51812573-51812595 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
955119657 3:56044812-56044834 CTCTGGGTTTGTATTTGATTTGG - Intronic
955216455 3:56988317-56988339 TTTTGTATTTGTAGTGGAGACGG + Intronic
955285263 3:57634260-57634282 TTCTGTGTTTTTAGTAGAGACGG - Intronic
955651711 3:61201877-61201899 TTCTGTGTTTGAAGTGGAAAGGG - Intronic
955672164 3:61412959-61412981 TTCTGGCTATGTTGTGGAGAAGG + Intergenic
956136332 3:66102770-66102792 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
956149081 3:66222350-66222372 TTTTGGGTTTTTAGTGGAGACGG + Intronic
956307966 3:67847492-67847514 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
956453420 3:69396332-69396354 TTTTGGATTTTTAGTGGAGAAGG - Intronic
956627223 3:71278608-71278630 GTTTGTGTTTGTAGTAGAGATGG - Intronic
957210222 3:77249020-77249042 TTCTGTGTTTTTAGTAGAGAAGG + Intronic
957402610 3:79735696-79735718 TTCTGGATTTTTAGTAGAGACGG - Intronic
957436957 3:80190046-80190068 CTCTGGGTTTGTGTGGGTGAGGG - Intergenic
957510712 3:81184488-81184510 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
958441769 3:94164253-94164275 TTTTGTGTTTGTAGTAGAGACGG - Intergenic
958806452 3:98816951-98816973 TTCTGTATTTTTAGTGGAGATGG + Intronic
958965233 3:100551183-100551205 TTCTGTATTTTTAGTGGAGACGG + Intronic
959391452 3:105780021-105780043 CTTTGGATTTTTAGTAGAGACGG + Intronic
959582094 3:107992635-107992657 TTTTGGATTTTTAGTGGAGACGG - Intergenic
959712715 3:109401023-109401045 CTTTGTGTTTTTAGTGGAGATGG + Intergenic
960009241 3:112815368-112815390 CTCTGGGCTTGTTGTGGGAAGGG - Intronic
960630161 3:119722284-119722306 CTCTGTATTTTTAGTAGAGACGG - Intronic
960794323 3:121469013-121469035 TTTTGTGTTTTTAGTGGAGACGG - Intronic
961012028 3:123442897-123442919 CTTTGGGTTTCGAGTGGAGGAGG - Intronic
961563979 3:127750237-127750259 TTCTGGGTTTGCTGTGGAGAAGG + Intronic
961749555 3:129087298-129087320 CATTGGGTTTGTGTTGGAGAGGG - Intergenic
962198536 3:133382732-133382754 CTCTGGGTTGTTAGTGCAGGAGG + Intronic
962223260 3:133582320-133582342 TTTTGTGTTTTTAGTGGAGATGG + Intronic
962715992 3:138126653-138126675 TTTTGTATTTGTAGTGGAGACGG - Intronic
963333445 3:143943398-143943420 CTCTGCATTTTTAGTAGAGACGG - Intergenic
963672424 3:148268754-148268776 CTCTGAGCTTGTAATGGAGGTGG + Intergenic
963704597 3:148670242-148670264 CCCTGTGTTTTTAGTAGAGATGG + Intergenic
964148224 3:153492095-153492117 TTTTGTGTTTGTAGTAGAGATGG - Intronic
964224095 3:154377535-154377557 TTTTGTATTTGTAGTGGAGACGG + Intronic
964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG + Intergenic
964740559 3:159960936-159960958 CTCTGTGTTTGATGTGGGGAGGG + Intergenic
965199689 3:165641875-165641897 ATCTGGTTCTGTTGTGGAGAAGG - Intergenic
965515980 3:169621584-169621606 TTTTGTGTTTTTAGTGGAGATGG - Intronic
966241738 3:177761755-177761777 TTTTGTATTTGTAGTGGAGACGG - Intergenic
966526119 3:180921195-180921217 TTTTGTGTTTTTAGTGGAGATGG - Intronic
966610955 3:181867618-181867640 CTCTGGGTTTCTAGTCATGAGGG - Intergenic
966772836 3:183519153-183519175 CTCTGGATTTGTAAAGGAGAGGG + Intronic
967305702 3:188057059-188057081 CTCCTGGTTTGTACTGGAAAGGG - Intergenic
967638215 3:191830610-191830632 TTTTGGATTTGTAGTAGAGACGG - Intergenic
968280425 3:197472844-197472866 TTTTGTGTTTGTAGTAGAGATGG + Intergenic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
968426158 4:524826-524848 TTTTGTGTTTTTAGTGGAGATGG + Intronic
968440125 4:619215-619237 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
968731605 4:2271770-2271792 GTCTGGGTGACTAGTGGAGAAGG + Exonic
969385043 4:6838956-6838978 TTCTGTATTTTTAGTGGAGATGG - Intronic
969474475 4:7413556-7413578 TTTTGTGTTTTTAGTGGAGATGG + Intronic
969910036 4:10435878-10435900 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
970086464 4:12352887-12352909 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
970405723 4:15761214-15761236 TTCTGTATTTTTAGTGGAGATGG + Intergenic
970667788 4:18358007-18358029 CTCTGGGATTGTAGTCAAGTGGG + Intergenic
970734621 4:19151524-19151546 CTCTGGGTTTTAAGTGGGGTGGG + Intergenic
970783288 4:19766138-19766160 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
971029465 4:22621050-22621072 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
971135631 4:23865011-23865033 TTTTGTGTTTTTAGTGGAGATGG - Intronic
971337896 4:25740953-25740975 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
972048159 4:34694796-34694818 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
972230936 4:37072087-37072109 CTCTGGGTTTGAGGTGGAAATGG - Intergenic
972496542 4:39639608-39639630 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
972561201 4:40230506-40230528 GTCTGTGTTTTTAGTAGAGATGG + Intronic
972774229 4:42226700-42226722 TTTTGTGTTTGTAGTAGAGACGG + Intergenic
973035271 4:45397967-45397989 CTTTGTATTTTTAGTGGAGACGG + Intergenic
973077171 4:45943595-45943617 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
973192261 4:47398960-47398982 TTCTGTATTTTTAGTGGAGACGG + Intronic
974656906 4:64836937-64836959 TTTTGTATTTGTAGTGGAGACGG + Intergenic
975276328 4:72505909-72505931 GCCTGGGTGTGGAGTGGAGATGG + Intronic
975816573 4:78223191-78223213 CTCTTGGTTTGGAATGGGGATGG + Intronic
975816585 4:78223240-78223262 CTCTTGGTTTGGAATGGGGATGG + Intronic
976165819 4:82253720-82253742 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
976216823 4:82722895-82722917 TTTTGTATTTGTAGTGGAGACGG - Intronic
976323192 4:83739423-83739445 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
976654703 4:87476481-87476503 CCCTGGGTTTGTATTTAAGATGG - Intronic
977412496 4:96685977-96685999 CTTTGTATTTTTAGTGGAGACGG - Intergenic
977588609 4:98802343-98802365 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
977749874 4:100596468-100596490 CTATAGGTCTGTAGTGAAGATGG - Intronic
977880418 4:102198136-102198158 TTTTGGGTTTTTAGTAGAGATGG + Intergenic
979872420 4:125840876-125840898 GTGTGTGTTTTTAGTGGAGATGG + Intergenic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
980654643 4:135766209-135766231 CTCTGGGTCTGTAATGTAGCAGG + Intergenic
980949694 4:139362441-139362463 TTTTGTGTTTTTAGTGGAGACGG + Intronic
981683280 4:147424534-147424556 CTCTGGGTTTGTTATATAGAAGG + Intergenic
981813394 4:148801316-148801338 CGCTGGGTGTGTGGTGGAGGCGG + Intergenic
982004677 4:151052159-151052181 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
982161019 4:152569486-152569508 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
982252516 4:153421453-153421475 GTTTGGATTTTTAGTGGAGATGG - Intergenic
982282531 4:153699604-153699626 CTGTTGGTTTGTAGTGGGGCAGG + Intergenic
982622318 4:157723871-157723893 CTCTGGGTTTGTGATGGAGGGGG - Intergenic
982843733 4:160223945-160223967 GCCTGGGTGTGGAGTGGAGAGGG + Intergenic
983212313 4:164971419-164971441 TTCTGTGTTTTTAGTAGAGACGG - Intronic
983456330 4:167969036-167969058 CTCTGCCTTTGAAGAGGAGAGGG + Intergenic
984153218 4:176160490-176160512 ATTTGTATTTGTAGTGGAGATGG + Intronic
984636954 4:182121166-182121188 TTCTGTATTTTTAGTGGAGACGG + Intergenic
984798557 4:183690030-183690052 TTTTGGGTTTTTAGTAGAGATGG - Intronic
984871994 4:184333873-184333895 CTTTGTATTTTTAGTGGAGATGG + Intergenic
984882926 4:184426184-184426206 TTTTGTGTTTTTAGTGGAGATGG + Intronic
984930204 4:184840485-184840507 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
985276103 4:188239504-188239526 CTCTGTATTTTTAGTAGAGATGG + Intergenic
986502825 5:8418010-8418032 TTGTGGGGTTGCAGTGGAGAAGG - Intergenic
987348505 5:16999845-16999867 TTCTGTATTTGTAGTAGAGATGG - Intergenic
987350497 5:17017730-17017752 CTCTGTATTTTTAGTAGAGATGG + Intergenic
987670548 5:21001915-21001937 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
987723786 5:21670728-21670750 CTCTGTATTTTTTGTGGAGATGG + Intergenic
987833771 5:23134439-23134461 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
988432006 5:31129952-31129974 TTCTGTATTTTTAGTGGAGATGG + Intergenic
989282740 5:39664569-39664591 TTTTGGGTTTTTAGTAGAGACGG - Intergenic
989595446 5:43152171-43152193 TTTTGTGTTTTTAGTGGAGACGG + Intronic
990402358 5:55451731-55451753 TTCTGTATTTGTAGTAGAGACGG + Intronic
990470268 5:56108864-56108886 TTTTGGATTTTTAGTGGAGACGG - Intronic
990542676 5:56790235-56790257 CTTTGGGTACTTAGTGGAGAAGG + Intergenic
990598149 5:57331566-57331588 CTTTGGATTTTTAGTAGAGATGG - Intergenic
992004332 5:72462719-72462741 CTTTGTGTTTTTAGTAGAGACGG + Intronic
992012689 5:72544987-72545009 TTTTGGGTTTTTAGTAGAGATGG + Intergenic
992524598 5:77596316-77596338 TTTTGTGTTTTTAGTGGAGACGG + Intronic
992565569 5:77992527-77992549 TTCTGGGCTTCTACTGGAGAAGG + Intergenic
992805476 5:80332864-80332886 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
993178303 5:84517115-84517137 TTCTGTATTTGTAGTAGAGATGG - Intergenic
993308563 5:86299242-86299264 TTCTGTGTTTGTACTGGAGGTGG - Intergenic
994096087 5:95849377-95849399 TTCTGCATTTCTAGTGGAGATGG + Intergenic
994649030 5:102504110-102504132 CTCTGGGCTTGTAATGGGAAGGG - Intergenic
994742957 5:103644005-103644027 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
994770948 5:103981086-103981108 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
994824790 5:104699028-104699050 GTCTGGGCTTGAAGTTGAGAGGG - Intergenic
994956924 5:106544834-106544856 CTCTGGGGTTGTAGTTGAATGGG + Intergenic
994959281 5:106578227-106578249 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
995421347 5:111970653-111970675 TTCTGTGTTTTTAGTGGAGGCGG - Intronic
995828172 5:116324897-116324919 TTTTGGATTTGTAGTAGAGATGG + Intronic
996390174 5:122951790-122951812 CTGTGGGTCTGTTGTGGAGGCGG + Intronic
997055450 5:130438273-130438295 GTCTGGGTGTGAAGTGGAGAGGG + Intergenic
997929122 5:138057891-138057913 TTCTGTATTTTTAGTGGAGATGG - Intergenic
997954662 5:138269669-138269691 TTTTGTATTTGTAGTGGAGATGG - Intronic
998245802 5:140503735-140503757 CTTTGTGTTTTTAGTAGAGACGG + Intronic
998962673 5:147505403-147505425 CTCTGTATTTTTAGTAGAGACGG + Intronic
1000694859 5:164368172-164368194 CTTTGTATTTTTAGTGGAGATGG - Intergenic
1001631476 5:173178620-173178642 CTCTGGGTGGGTGGTGGTGACGG + Intergenic
1001909579 5:175504402-175504424 TTTTGTGTTTGTAGTAGAGACGG - Intronic
1002042722 5:176526531-176526553 TTCTGTGTTTTTAGTAGAGAAGG + Intergenic
1002118904 5:176986187-176986209 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1002119994 5:176995669-176995691 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1002153260 5:177254116-177254138 TTTTGGATTTTTAGTGGAGACGG + Intronic
1002202816 5:177540132-177540154 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1002827288 6:785121-785143 CCCTGGGCTTCTTGTGGAGATGG - Intergenic
1003127221 6:3364879-3364901 CTCTGGCGGTGTGGTGGAGAGGG + Intronic
1003860342 6:10317119-10317141 TTGTGTGTTTTTAGTGGAGACGG + Intergenic
1004362812 6:14986194-14986216 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1004485914 6:16066360-16066382 CTTTGTATTTTTAGTGGAGATGG + Intergenic
1004819421 6:19350781-19350803 TTATGTGTTTTTAGTGGAGATGG - Intergenic
1004967816 6:20874671-20874693 TTCTGTATTTTTAGTGGAGATGG + Intronic
1005042028 6:21608491-21608513 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
1005148522 6:22721129-22721151 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1005302653 6:24485837-24485859 TTTTGGATTTTTAGTGGAGATGG + Intronic
1005815721 6:29550754-29550776 CTCTGGATTTGAAATGGAGTTGG - Intergenic
1005994659 6:30923929-30923951 CTCTGGGGTGGCAGTGGAGCGGG - Intronic
1006225164 6:32531377-32531399 CTTTGTATTTTTAGTGGAGATGG + Intergenic
1006660929 6:35643633-35643655 CACTGGGTTTGTTGTAGAGGTGG - Intronic
1006673282 6:35743386-35743408 TTTTGTTTTTGTAGTGGAGATGG + Intronic
1006728207 6:36215284-36215306 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1006938978 6:37738819-37738841 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1007120986 6:39381225-39381247 GTTTGGGTTTGTCGTGGGGAAGG - Intronic
1007562743 6:42824063-42824085 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1007593123 6:43035431-43035453 CTTTGAGTTTCTGGTGGAGAAGG + Intergenic
1007603871 6:43102252-43102274 TTTTGGGTTTTTAGTAGAGATGG - Intronic
1007877892 6:45127141-45127163 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1008110079 6:47482548-47482570 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1008639135 6:53443533-53443555 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1008959567 6:57252609-57252631 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1009185935 6:60574525-60574547 TTTTGTATTTGTAGTGGAGATGG + Intergenic
1009369872 6:62885731-62885753 CTCTGGGTAGGAAATGGAGAAGG + Intergenic
1009924389 6:70102393-70102415 CTCTTGGTTTGTGGTGATGATGG - Intronic
1010256509 6:73764642-73764664 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1010349785 6:74859764-74859786 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1010440701 6:75890513-75890535 TTTTGTATTTGTAGTGGAGACGG + Intronic
1011601021 6:89060646-89060668 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1011729813 6:90249599-90249621 TTTTGTGTTTGTAGTAGAGATGG - Intronic
1012352508 6:98270000-98270022 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1012470712 6:99569595-99569617 CTTTGTATTTTTAGTGGAGAGGG + Intergenic
1012470971 6:99571814-99571836 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1012768006 6:103394321-103394343 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1012889540 6:104882919-104882941 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1012947339 6:105481524-105481546 CTTTGGGTTAGCAGTGGAGGTGG + Intergenic
1013011615 6:106125730-106125752 TTCTGGATTTTTAGTAGAGATGG - Intergenic
1013219446 6:108065027-108065049 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1013296469 6:108762097-108762119 CTTTGCATTTGTAGTAGAGATGG - Intergenic
1013320941 6:108988433-108988455 CTTTGGGTTGGTAGGGGTGATGG + Intronic
1013361994 6:109402363-109402385 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1013570641 6:111420965-111420987 TTTTGTGTTTTTAGTGGAGAGGG - Intronic
1014150976 6:118054945-118054967 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1014327646 6:120018623-120018645 CTCTGGGTCTGTAATGGGGGTGG + Intergenic
1014451133 6:121583242-121583264 TTTTGGGTTTTTAGTAGAGACGG + Intergenic
1014552099 6:122800919-122800941 TTTTGTGTTTGTAGTAGAGATGG + Intronic
1014562703 6:122910400-122910422 CTTTGTATTTTTAGTGGAGACGG + Intergenic
1015157048 6:130108404-130108426 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1015592317 6:134833847-134833869 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1015767130 6:136730547-136730569 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1015904023 6:138097828-138097850 TTCTGGATTGTTAGTGGAGATGG - Intronic
1015976199 6:138793790-138793812 GTATGTGTTTTTAGTGGAGATGG - Intergenic
1016186235 6:141200567-141200589 CTGTGTGTTTGTTTTGGAGATGG - Intergenic
1016198715 6:141380069-141380091 CTCTGGGTTTGTCCTGGTGTTGG - Intergenic
1016475247 6:144420083-144420105 CTCTGAGTTTGAAATGGAGGAGG - Intronic
1016835585 6:148473422-148473444 TTCTGTATTTTTAGTGGAGATGG + Intronic
1016947171 6:149546016-149546038 CCCGGGGTTTGTAGCGGAGGAGG - Exonic
1017398455 6:154030717-154030739 CTCTGTATTTTTAGTAGAGATGG - Intronic
1017478887 6:154829734-154829756 TTCTGTATTTTTAGTGGAGACGG - Intronic
1017705036 6:157114350-157114372 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1017787682 6:157769778-157769800 CACTGGGTGTGTTGTGGGGAGGG + Intronic
1017794895 6:157835181-157835203 TTCTGTATTTTTAGTGGAGATGG + Intronic
1017904619 6:158749049-158749071 CTCTGTATTTTTAGTAGAGACGG - Intronic
1018169340 6:161132093-161132115 CTCCGGTTTTGGAGTGCAGAGGG + Exonic
1018887284 6:167950740-167950762 GTCTGGCTCTGCAGTGGAGATGG + Intronic
1019144079 6:169965759-169965781 CTGTCAGTTCGTAGTGGAGAGGG + Intergenic
1020531184 7:9337823-9337845 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1020675362 7:11177800-11177822 TTCTGGGTTTTGAGGGGAGAAGG - Intergenic
1020806044 7:12791421-12791443 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1021280950 7:18717599-18717621 CTCTGTATTTTTAGTGGAGATGG + Intronic
1021775504 7:24050792-24050814 TTTTGTGTTTTTAGTGGAGAGGG + Intergenic
1022650849 7:32273025-32273047 CACTGGCTTTGAAATGGAGATGG + Intronic
1023495656 7:40793181-40793203 CTCTGGGTTTGCAGAAGAGGTGG + Intronic
1024025162 7:45403856-45403878 CTCAGGGTTCCAAGTGGAGATGG - Intergenic
1024836375 7:53524292-53524314 TTTTGTGTTTGTAGTAGAGACGG + Intergenic
1025009058 7:55381039-55381061 TTTTGTGTTTTTAGTGGAGATGG + Intronic
1025159861 7:56647108-56647130 TTTTGGGTATGCAGTGGAGAGGG - Intergenic
1025164164 7:56695986-56696008 TTTTGGGCTTGCAGTGGAGATGG - Intergenic
1025293092 7:57748668-57748690 GTGTGTGTTTTTAGTGGAGACGG - Intergenic
1025297242 7:57785573-57785595 CTTTGTCTTTTTAGTGGAGATGG + Intergenic
1025298012 7:57792207-57792229 CTTTGTTTTTTTAGTGGAGATGG + Intergenic
1025612913 7:63094013-63094035 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1025706118 7:63866085-63866107 TTTTGGGCTTGCAGTGGAGATGG + Intergenic
1025726858 7:64072228-64072250 TTTTGGGTATGCAGTGGAGAGGG + Intronic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026303133 7:69116321-69116343 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1026542006 7:71287879-71287901 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1026850029 7:73718618-73718640 CTCTGGGTGTGTCGGGGAGGGGG - Intronic
1027180088 7:75932845-75932867 CTTTGTATTTGTAGTAGAGATGG - Intronic
1027246632 7:76372023-76372045 TTTTGGGTTTTTAGTAGAGATGG - Intergenic
1027255800 7:76430049-76430071 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1027394552 7:77741155-77741177 TTTTGTGTTTGTAGTAGAGATGG + Intronic
1027762097 7:82291960-82291982 GTGTGTGTTTGTAGTGGGGAAGG - Intronic
1027824755 7:83097348-83097370 TTTTGTATTTGTAGTGGAGATGG - Intronic
1028339851 7:89705174-89705196 CACTGGGGTTGTAGAAGAGAAGG - Intergenic
1029040169 7:97565017-97565039 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1029229656 7:99055792-99055814 TTTTGTATTTGTAGTGGAGACGG - Intronic
1029533610 7:101142109-101142131 TTGTGTGTTTTTAGTGGAGACGG - Intergenic
1029677984 7:102084593-102084615 TTTTGGATTTTTAGTGGAGACGG + Intronic
1029727816 7:102419241-102419263 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1029839421 7:103346301-103346323 TTCTGTATTTGTAGTAGAGACGG + Intronic
1030068035 7:105675450-105675472 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1030521458 7:110603233-110603255 TTTTGTGTTTGTAGTAGAGACGG + Intergenic
1030666131 7:112280796-112280818 TTTTGTGTTTGTAGTGGAGATGG + Intronic
1030845102 7:114400025-114400047 CTCTGTATTTTTAGTAGAGACGG + Intronic
1031652710 7:124310998-124311020 ATCTGGGTGAGTAGTTGAGAAGG + Intergenic
1032020186 7:128403385-128403407 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1032438705 7:131924215-131924237 TTCTGTATTTTTAGTGGAGACGG + Intergenic
1032694700 7:134324963-134324985 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1032811184 7:135419870-135419892 TTTTGGATTTTTAGTGGAGATGG - Intronic
1032827110 7:135581679-135581701 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1033158613 7:138977868-138977890 CTCTGTATTTTTAGTAGAGACGG + Intronic
1033179084 7:139157315-139157337 CTTTGGATTTTTAGTAGAGATGG + Intronic
1033576497 7:142690310-142690332 CTTTGTATTTTTAGTGGAGATGG - Intergenic
1033950699 7:146781054-146781076 CTCTGTATTTTTAGTAGAGACGG - Intronic
1033959913 7:146902054-146902076 TTTTGTATTTGTAGTGGAGACGG + Intronic
1033990108 7:147272677-147272699 TTTTGTATTTGTAGTGGAGATGG + Intronic
1033997189 7:147365231-147365253 TTCTGTATTTGTAGTAGAGACGG - Intronic
1034005686 7:147469688-147469710 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1034180231 7:149131513-149131535 TTCTGTATTTGTAGTAGAGATGG - Intronic
1034181195 7:149139548-149139570 CTTTGTATTTTTAGTGGAGACGG - Intronic
1034327451 7:150249623-150249645 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1034698700 7:153077899-153077921 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1034765760 7:153719822-153719844 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1035141588 7:156768204-156768226 CTTTGTGTTTTTAGTAGAGACGG - Intronic
1035142531 7:156777105-156777127 CTCTGTATTTTTAGTAGAGATGG + Intronic
1035208839 7:157312746-157312768 CTCTGCATTTTTAGTAGAGATGG - Intergenic
1035251556 7:157600577-157600599 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1035938229 8:3866714-3866736 CTGTGGCTTTGTAGTGGCCAAGG - Intronic
1036512079 8:9409894-9409916 TTCTGTGTTTTTAGTAGAGATGG - Intergenic
1036599049 8:10242099-10242121 TTCTGTGTTTTTAGTAGAGATGG - Intronic
1037476225 8:19260425-19260447 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1037519086 8:19662211-19662233 TTTTGTATTTGTAGTGGAGATGG - Intronic
1038145759 8:24894102-24894124 TTTTGTGTTTGTAGTAGAGACGG - Intergenic
1039277571 8:35950699-35950721 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1039634766 8:39152549-39152571 CTTTGTATTTTTAGTGGAGACGG - Intronic
1039932971 8:42011565-42011587 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1040395790 8:46998976-46998998 TTCAGGGTTGGTTGTGGAGAAGG + Intergenic
1041085737 8:54254768-54254790 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1041109620 8:54472252-54472274 CTTTGTGTTTTTAGTAGAGACGG - Intergenic
1041361152 8:57055542-57055564 TTTTGGATTTTTAGTGGAGATGG - Intergenic
1041481633 8:58327894-58327916 TTTTGGGTTTTTAGTAGAGACGG - Intergenic
1041887669 8:62830635-62830657 GCCTGGGCTTGGAGTGGAGAGGG - Intronic
1042164398 8:65931317-65931339 ATGTGTGTTTGTGGTGGAGATGG + Intergenic
1042921778 8:73927225-73927247 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1042924357 8:73952231-73952253 TTTTGTGTTTTTAGTGGAGATGG - Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1043418130 8:80072135-80072157 CTTTGTGTTTTTAGTTGAGACGG - Intronic
1043937249 8:86155866-86155888 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1044077950 8:87846640-87846662 TTTTGTGTTTTTAGTGGAGATGG + Intergenic
1044090061 8:87989419-87989441 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1044233645 8:89806631-89806653 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1044671906 8:94690301-94690323 TTTTGGATTTTTAGTGGAGATGG + Intronic
1046604040 8:116350950-116350972 CTCAGGGTTTGGAGTAGAGACGG - Intergenic
1046631280 8:116625278-116625300 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1046662974 8:116968905-116968927 TTTTGTGTTTTTAGTGGAGAGGG + Intronic
1047084304 8:121499196-121499218 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1047491360 8:125377263-125377285 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1047738070 8:127784080-127784102 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1047738574 8:127788557-127788579 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1047796136 8:128257715-128257737 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1048471281 8:134706519-134706541 TTCTGTATTTTTAGTGGAGACGG - Intronic
1048935572 8:139352984-139353006 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1049167963 8:141138554-141138576 TTTTGTGTTTTTAGTGGAGACGG + Intronic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1049821006 8:144633284-144633306 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1050877338 9:10654989-10655011 TTCTGGATTTTTAGTAGAGATGG + Intergenic
1051056989 9:12999764-12999786 TTTTGGATTTTTAGTGGAGATGG - Intergenic
1051791904 9:20814525-20814547 TTCTGTGTTTTTAGTAGAGATGG + Intronic
1051873848 9:21769825-21769847 TTTTGTGTTTGTAGTAGAGATGG - Intergenic
1052116483 9:24653918-24653940 CACAAGGTTTGTAGTGGAGTGGG + Intergenic
1052205170 9:25830272-25830294 CTTTGTGTTTTTAGTAGAGATGG + Intergenic
1052307259 9:27024352-27024374 CTCTGGGCTTGTACTTGGGAGGG - Intronic
1052512310 9:29437620-29437642 CTCTGTGTGTGTATTGCAGAGGG - Intergenic
1052786774 9:32835702-32835724 CTTTGTATTTGTAGTAGAGATGG - Intergenic
1053235122 9:36446634-36446656 TTCTGTGTTTTTAGTAGAGACGG - Intronic
1053408778 9:37901336-37901358 TTCTGTATTTTTAGTGGAGACGG + Intronic
1053446833 9:38159184-38159206 CCCTTGGTTTGAAGTGGAGTGGG + Intergenic
1053795591 9:41723832-41723854 CTTTGTTTTTTTAGTGGAGATGG - Intergenic
1054149595 9:61591044-61591066 CTTTGTTTTTTTAGTGGAGATGG + Intergenic
1054184001 9:61935887-61935909 CTTTGTTTTTTTAGTGGAGATGG - Intergenic
1054469357 9:65522154-65522176 CTTTGTTTTTTTAGTGGAGATGG + Intergenic
1054654504 9:67652599-67652621 CTTTGTTTTTTTAGTGGAGATGG + Intergenic
1054703181 9:68434633-68434655 CTTTGTGTTTTTAGTAGAGATGG - Intronic
1055541001 9:77305108-77305130 TTTTGTGTTTGTAGTAGAGACGG + Intronic
1055615816 9:78071254-78071276 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1055782378 9:79833266-79833288 CTCTGGGATTATAATGGAAAGGG + Intergenic
1055840268 9:80494743-80494765 CTCTGGGTTTGTGATGGGAAAGG + Intergenic
1056344111 9:85672903-85672925 TTTTGGATTTTTAGTGGAGACGG + Intronic
1056415206 9:86368814-86368836 TTCTGGATTTTTAGTAGAGATGG + Intergenic
1057249031 9:93484742-93484764 CTTTGTATTTTTAGTGGAGATGG + Intronic
1057426106 9:94951012-94951034 CTCTGTGGTTGTGGTGGAAAAGG + Intronic
1057484484 9:95471865-95471887 CTTTGTGTTTTTAGTAGAGATGG - Intronic
1057967556 9:99518940-99518962 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1058472185 9:105291504-105291526 CTGTGGGATTGTTTTGGAGATGG + Intronic
1058871160 9:109202666-109202688 CTCTGGGTTTGGGGTGGTGGTGG + Intronic
1059687440 9:116651085-116651107 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1060634219 9:125187452-125187474 TTCTGTGTTTTTAGTAGAGAGGG + Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060834535 9:126745173-126745195 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1061085467 9:128395525-128395547 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061453133 9:130679501-130679523 CTTTGCATTTGTAGTAGAGATGG + Intronic
1061456927 9:130705345-130705367 TTCTGTATTTTTAGTGGAGACGG - Intergenic
1061468337 9:130801396-130801418 TTCTGTGTTTTTAGTAGAGACGG + Intronic
1061688054 9:132299956-132299978 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1062542571 9:137048179-137048201 GTCTGGGTCTGTACTGGGGAGGG - Exonic
1185469550 X:374228-374250 CTCTGGTGTTGTCGTGGAGGGGG - Intronic
1185473548 X:399679-399701 CTTTGTATTTTTAGTGGAGATGG + Intergenic
1185534154 X:846328-846350 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1185570726 X:1132912-1132934 TTTTGGGTTTTTAGTAGAGACGG - Intergenic
1185608995 X:1383179-1383201 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1187174675 X:16885531-16885553 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1187217941 X:17295279-17295301 CTCTGTGTATGAAGTGGACAAGG + Intergenic
1187550049 X:20293391-20293413 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1187768530 X:22669593-22669615 CTTTGTATTTTTAGTGGAGACGG - Intergenic
1187900435 X:24022902-24022924 CTTTGTGTTTTTAGTAGAGACGG + Intronic
1187936634 X:24342604-24342626 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1188187551 X:27133235-27133257 CTCTGGGTTATTACTGGAGAAGG - Intergenic
1188784756 X:34332066-34332088 CTGTGTGTGTTTAGTGGAGATGG - Intergenic
1189170135 X:38901144-38901166 TTTTGTGTTTGTAGTAGAGACGG + Intergenic
1189359910 X:40341998-40342020 CTTTGTATTTTTAGTGGAGACGG + Intergenic
1189799250 X:44676609-44676631 TTCTGTATTTTTAGTGGAGATGG - Intergenic
1189949401 X:46213418-46213440 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1190641325 X:52484059-52484081 CTCTGGGTTTTCAGTGGGGTGGG - Intergenic
1190646347 X:52528806-52528828 CTCTGGGTTTTCAGTGGGGTGGG + Intergenic
1190884351 X:54518379-54518401 CTCTGTATTTTTAGTAGAGATGG - Intergenic
1191130920 X:57009643-57009665 TTCTGTGTTTTTAGTAGAGATGG + Intergenic
1191647837 X:63502871-63502893 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1192062208 X:67839105-67839127 CCCTGGGACTGTAGTGGTGATGG + Intergenic
1192134814 X:68587130-68587152 CTTTGTGTTTTTAGTAGAGATGG - Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192415386 X:70975207-70975229 TTTTGTGTTTTTAGTGGAGACGG - Intergenic
1192601608 X:72470253-72470275 CTCTGGGGTGGAAGTTGAGATGG - Intronic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193487844 X:82108525-82108547 TTTTGGATTTGTAGTAGAGACGG + Intergenic
1193584086 X:83299505-83299527 CTTTGTATTTTTAGTGGAGATGG + Intergenic
1195216188 X:102705618-102705640 CTCTGTATTTTTAGTAGAGATGG + Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1196144133 X:112297923-112297945 CTCTGGGTTTCTTGAGGACAGGG + Intergenic
1196188511 X:112770900-112770922 TTTTGTGTTTTTAGTGGAGATGG - Intergenic
1196631836 X:117950294-117950316 TTTTGTGTTTTTAGTGGAGACGG - Intronic
1197253211 X:124236012-124236034 CTTTGTGTTTTTAGTAGAGATGG + Intronic
1198240517 X:134780403-134780425 TTTTGTATTTGTAGTGGAGATGG - Intronic
1199225208 X:145364900-145364922 TTTTGGGTTTTTAGTAGAGACGG + Intergenic
1199368533 X:147017951-147017973 TTTTGTGTTTTTAGTGGAGACGG + Intergenic
1199374189 X:147088090-147088112 CTCTGCGTTTGGAAAGGAGATGG - Intergenic
1199546722 X:149013942-149013964 CTCAGGATTTGTAGAGGGGAGGG - Intergenic
1199798339 X:151224750-151224772 CTTTGTGTTTTTAGTAGAGACGG + Intergenic
1200748537 Y:6923687-6923709 ATCTGTATTTTTAGTGGAGACGG + Intronic
1200860761 Y:7989266-7989288 CTGTGTGTGTGTAGTGGGGATGG - Intergenic
1200946588 Y:8847084-8847106 TTTTGGATTTTTAGTGGAGATGG - Intergenic
1202339320 Y:23844676-23844698 TTCTGTGTTTTTAGTAGAGACGG + Intergenic
1202531446 Y:25825392-25825414 TTCTGTGTTTTTAGTAGAGACGG - Intergenic
1202585272 Y:26417433-26417455 TTCTGTATTTGTAGTAGAGAGGG - Intergenic