ID: 1164281703

View in Genome Browser
Species Human (GRCh38)
Location 19:23774785-23774807
Sequence GTCTGTGCCCTGATTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164281701_1164281703 -3 Left 1164281701 19:23774765-23774787 CCATGTGATATGACTCTACTGTC 0: 1
1: 1
2: 1
3: 31
4: 243
Right 1164281703 19:23774785-23774807 GTCTGTGCCCTGATTTCAGGAGG 0: 1
1: 1
2: 1
3: 25
4: 178
1164281700_1164281703 -2 Left 1164281700 19:23774764-23774786 CCCATGTGATATGACTCTACTGT 0: 1
1: 0
2: 12
3: 69
4: 461
Right 1164281703 19:23774785-23774807 GTCTGTGCCCTGATTTCAGGAGG 0: 1
1: 1
2: 1
3: 25
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164281703 Original CRISPR GTCTGTGCCCTGATTTCAGG AGG Intronic
900727851 1:4230057-4230079 GCCTGTCCCCTGGTTTCTGGGGG + Intergenic
900785737 1:4649003-4649025 GACTGAGCCCTGAGTACAGGAGG - Intergenic
900785754 1:4649141-4649163 GACTGAGCCCTGAGTACAGGAGG - Intergenic
906517390 1:46447842-46447864 GTCTGTGCCCAGAATTCACGGGG + Intergenic
908815453 1:68028204-68028226 GTCTTAGCCCTGATCTTAGGTGG - Intergenic
908860159 1:68476066-68476088 CTATATGCCCTGATTTCAGTGGG + Exonic
914863678 1:151407576-151407598 GTCTGTGCTCTAATTTCATAGGG - Intronic
918378153 1:183929651-183929673 TTACGTGTCCTGATTTCAGGGGG + Intergenic
921587248 1:216962438-216962460 GTCTCTGCCATGCTTTCAAGTGG - Intronic
922015721 1:221644574-221644596 GTCTGAGCCATGATTTCTGCTGG - Intergenic
924148070 1:241097731-241097753 CTCTGTGCTCTGACTCCAGGGGG - Intronic
1062874245 10:932039-932061 GTGTGGGCCCTGACTTCCGGAGG + Intergenic
1064202136 10:13293859-13293881 GTCTATGCCATGATTTTAGGAGG - Intronic
1064635496 10:17362080-17362102 GTCTTTTTCCTGATTTTAGGGGG - Intronic
1064894083 10:20214401-20214423 GTCTCTGCCCTAATGTGAGGAGG + Intronic
1066041998 10:31557555-31557577 GCCTTTGCTCTGAGTTCAGGTGG - Intergenic
1067258448 10:44665777-44665799 CTCTCTGTGCTGATTTCAGGTGG - Intergenic
1067285298 10:44903438-44903460 GTCAGTGCCCTGTTTCAAGGAGG + Intergenic
1069903058 10:71716977-71716999 GTCAGTGCCCTGTCTACAGGGGG - Intronic
1070767480 10:79065155-79065177 GCCTGGGCCCAGGTTTCAGGAGG - Intergenic
1072183724 10:93014210-93014232 GCCTGTGCCAGGATTCCAGGGGG + Exonic
1077208353 11:1354936-1354958 GTCTGTGCCATGATTTTAAGTGG + Intergenic
1078659535 11:13276294-13276316 GTCTCTGCCCCCATTTCATGAGG - Intergenic
1079125975 11:17719192-17719214 CTCTGTCCCCTGATTTGTGGGGG - Intergenic
1080654909 11:34251241-34251263 CTCTGCACCCTGATTTCAGAGGG + Intronic
1090441770 11:126730341-126730363 GATTGTTCCCTGATTTCTGGTGG - Intronic
1094642195 12:32287123-32287145 GTCTGTGGATAGATTTCAGGAGG + Intronic
1095458531 12:42416407-42416429 GTGTATGCACTGATTCCAGGTGG - Intronic
1096146418 12:49282131-49282153 GCCTGTGGCCTGATGTGAGGGGG + Intergenic
1098990388 12:77059425-77059447 GTCTGGGCCCAGATTTCCGTAGG + Intronic
1099339779 12:81414266-81414288 GTTTGTGGTCTGATTGCAGGGGG + Intronic
1102608756 12:114092165-114092187 GTTTATGGCCAGATTTCAGGGGG - Intergenic
1102755106 12:115333424-115333446 GACTATACTCTGATTTCAGGAGG - Intergenic
1104979528 12:132567603-132567625 ATCTCTCCCCTGACTTCAGGGGG - Intronic
1106860871 13:33906911-33906933 CTCTGTGTCCCGAGTTCAGGTGG + Intronic
1110545914 13:76755297-76755319 GTCTGTACCCTCATGTCTGGGGG + Intergenic
1111751880 13:92343252-92343274 GTCTGTGCCTTCATCCCAGGAGG + Intronic
1114126182 14:19729405-19729427 GTCTTTGCTCTGAGTTCAGCTGG + Intronic
1121863168 14:97338248-97338270 GTCTGTGCCTTGTCTTCATGTGG + Intergenic
1121917671 14:97851023-97851045 CTTTGTGCCCTGACTTCAGCAGG + Intergenic
1123214323 14:106792365-106792387 GTGTGTTTCCTTATTTCAGGTGG + Intergenic
1123569705 15:21591619-21591641 GTCTTTGCTCTGAGTTCAGTTGG + Intergenic
1123605815 15:22026938-22026960 GTCTTTGCTCTGAGTTCAGTTGG + Intergenic
1124684129 15:31764888-31764910 CTATATGCCCTGATTTCAGTGGG + Intronic
1128283210 15:66414502-66414524 GACTGTGCCCTGATTCCAAGAGG - Intronic
1128485854 15:68087534-68087556 GTCTGTGGCCTGTTTTTATGTGG + Intronic
1128719605 15:69938634-69938656 GTGTGTGCCATTGTTTCAGGGGG + Intergenic
1128797344 15:70475552-70475574 GTGTGTGCCCGGCTTTCAGAGGG + Intergenic
1129607054 15:77030108-77030130 TTCTGTGCCCAGATCTCTGGAGG - Intronic
1129755230 15:78094061-78094083 GTCTGTGCCCTAATGGCAGCAGG - Intronic
1130053121 15:80500279-80500301 TTCTGGGCCCCCATTTCAGGGGG + Intronic
1202978055 15_KI270727v1_random:318710-318732 GTCTTTGCTCTGAGTTCAGTTGG + Intergenic
1132556957 16:576755-576777 GTCTGTGCCCCGTTTCCAGCCGG + Intronic
1138914348 16:61444901-61444923 GTCTCTTCTCTGAATTCAGGAGG - Intergenic
1139009763 16:62617367-62617389 ATCTGTGCTCTGATCTCAAGTGG + Intergenic
1140432119 16:74913222-74913244 GTTTATGGCCAGATTTCAGGGGG + Intronic
1143141696 17:4744910-4744932 GTCTCTGCCCCGGTTACAGGTGG + Exonic
1143419810 17:6779936-6779958 GTCTGTGCCGTGTTTTCTGGTGG + Exonic
1146925848 17:36744157-36744179 GTCACAGCCCTAATTTCAGGAGG - Intergenic
1147612944 17:41812223-41812245 CTCAGTGTCCTGATCTCAGGCGG - Intronic
1147946650 17:44084168-44084190 GTCTGAGCCCTCATTTTTGGTGG - Intronic
1150226237 17:63526065-63526087 ATCTGAGTCCTGATCTCAGGGGG - Intronic
1150265782 17:63831629-63831651 GCCTCTGCCCTGTTTTCAGTGGG - Intronic
1151760715 17:76101206-76101228 GTCTCTGCCCTGGTCTCATGAGG - Intronic
1203163347 17_GL000205v2_random:71706-71728 GCTTGTACTCTGATTTCAGGAGG - Intergenic
1155702532 18:28765250-28765272 GTCTGAGCCCTAATTTAACGAGG + Intergenic
1161089849 19:2354270-2354292 GTCTCTGCCCTGGAGTCAGGAGG - Intronic
1161519719 19:4717043-4717065 GGCTGTGGGCTGATTTCTGGAGG + Intronic
1163987662 19:20968535-20968557 TCCTGGGCCCTGATCTCAGGGGG - Intergenic
1164041137 19:21493681-21493703 GCCTGTCCCCTGCTTTCAGGAGG + Intergenic
1164041316 19:21494940-21494962 GACTGTGCCTTGCTTTCAGGAGG + Intergenic
1164086745 19:21909516-21909538 TCCTGTGCCCTGCTTTCAAGAGG + Intergenic
1164099702 19:22043915-22043937 GACTGTGCCCTGCTTTTAGAAGG - Intergenic
1164126770 19:22325571-22325593 ACCTGTGCCCTGCTTTCAGGTGG + Intergenic
1164172571 19:22738233-22738255 ACCTGTGCCCTACTTTCAGGAGG - Intergenic
1164180653 19:22815450-22815472 GCCTGTGCTCTGCTTTCAGGAGG + Intergenic
1164204535 19:23047232-23047254 GTCTGTGTCTTGCTTTCAGGAGG - Intergenic
1164205610 19:23056194-23056216 GCCTGTGTCCTGCTTTTAGGAGG - Intergenic
1164206479 19:23063232-23063254 GAGTGTGCCCTGCTTTCAGGAGG - Intergenic
1164227666 19:23260250-23260272 ACCTGTGCCCTGCTTTCAGGAGG - Intergenic
1164233676 19:23313574-23313596 GCCCGTGTCCTGCTTTCAGGAGG + Intronic
1164281703 19:23774785-23774807 GTCTGTGCCCTGATTTCAGGAGG + Intronic
1164303809 19:23985802-23985824 GTCTGTGCCCTGCTTTCAGTGGG - Intergenic
1164312307 19:24056795-24056817 GTCTGTGCCCTGGTTTCAGGAGG + Intronic
1164325474 19:24187593-24187615 GCCTGCACCCTGCTTTCAGGAGG - Intergenic
1164325815 19:24190531-24190553 GTCCGTGACCTGCTTTCAGGAGG - Intergenic
1164706460 19:30323712-30323734 GTCTGGGCCATGATTAGAGGTGG + Intronic
1167667926 19:50833459-50833481 CACTGTGCCCTGGTTTCAAGGGG - Intronic
925055937 2:857396-857418 GCCTGGGCTCTGTTTTCAGGAGG + Intergenic
925131162 2:1495105-1495127 GCCTCTGCACTGATTTCAGATGG - Intronic
925316516 2:2930695-2930717 GGCTTTACCCTGAGTTCAGGTGG - Intergenic
925917391 2:8616327-8616349 GTCTGTGCCCCAATCCCAGGAGG - Intergenic
926619956 2:15038626-15038648 TTCTGTGTCGTGATGTCAGGTGG + Intergenic
927029226 2:19103365-19103387 CTCTGTTCCCTGATTGCTGGGGG - Intergenic
927541773 2:23918534-23918556 TTCTGCAGCCTGATTTCAGGAGG - Intronic
933112414 2:78420438-78420460 GTCTGTGCCCAGTTTGCAGATGG + Intergenic
934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG + Intronic
936156852 2:110052584-110052606 GTGTGAGCCCTGACTTCAGAAGG + Intergenic
936187842 2:110318860-110318882 GTGTGAGCCCTGACTTCAGAAGG - Intergenic
937430876 2:121837008-121837030 GCCTGTGATCTGAGTTCAGGCGG + Intergenic
937897618 2:126990513-126990535 GTCTCTTCCCTGGTTTCAGCAGG - Intergenic
941044523 2:160657531-160657553 GTCTGTCCACTGATTTCCAGTGG - Intergenic
943609771 2:190018897-190018919 GTCTTTGCTCTGAGTTTAGGTGG + Intronic
944981371 2:205124436-205124458 TTCTGTCCCCTGATTGTAGGCGG - Exonic
946310067 2:218878327-218878349 GGCTCTGCCCTGGTGTCAGGAGG - Intergenic
948430610 2:237916161-237916183 TACTGAGCCGTGATTTCAGGAGG - Intergenic
1169400231 20:5273595-5273617 GTCTGTTCTCTCATTCCAGGGGG - Intergenic
1169920465 20:10729729-10729751 ATCTGTGCCTTGGTTTGAGGTGG + Intergenic
1171121439 20:22572373-22572395 GCCTGAGCCCTGATTTGAGGAGG + Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1176338132 21:5618113-5618135 GCTTGTACTCTGATTTCAGGAGG + Intergenic
1176339540 21:5681186-5681208 GCTTGTACTCTGATTTCAGGAGG + Intergenic
1176471794 21:7113339-7113361 GCTTGTACTCTGATTTCAGGAGG + Intergenic
1176495355 21:7495117-7495139 GCTTGTACTCTGATTTCAGGAGG + Intergenic
1176505287 21:7643270-7643292 GCTTGTACTCTGATTTCAGGAGG - Intergenic
1177164406 21:17583626-17583648 GTCTGTTCACTGATACCAGGGGG - Intronic
1177724321 21:24947370-24947392 GTCTCTGCACTGATTTTATGGGG + Intergenic
1178518321 21:33266736-33266758 GTCTGGGCCCTAAACTCAGGGGG + Intronic
1179072183 21:38082012-38082034 GGCTGTTCCCTATTTTCAGGAGG + Intronic
1185015025 22:48337836-48337858 GTCTGTGTTCTCATTTCAGACGG - Intergenic
953465428 3:43115357-43115379 GTCTGTGGCCTGATTGGATGAGG - Intergenic
956376583 3:68619846-68619868 GTATATGACCTGATTTAAGGAGG - Intergenic
957391662 3:79580954-79580976 GCCTGTGCTCTGATTTCACGTGG - Intronic
957598902 3:82306392-82306414 GTCTGAGCTCTGCTATCAGGTGG - Intergenic
958144999 3:89612630-89612652 GTCTTTTTCCTGATTTTAGGTGG + Intergenic
961444013 3:126970182-126970204 GTCTGTCCCCTGCTTTCCGTGGG + Intergenic
964404321 3:156332661-156332683 GACTGTGCTCTGATTGCTGGAGG - Intronic
964744319 3:159998019-159998041 GTCTGGGCCCAGAGATCAGGAGG + Intergenic
965509783 3:169555637-169555659 GTCTGTGTCCTGTTCTCAGAAGG + Intronic
967829908 3:193909870-193909892 GTCTGTGCCCTGCTTCAAGGTGG + Intergenic
968706130 4:2078828-2078850 GTCTGTGTCCAGCTTTCAGAAGG + Intronic
970610794 4:17723429-17723451 TTCTGTGCCCTGACTGCACGTGG + Intronic
971115379 4:23640290-23640312 GTCTGTACCCTGATTTCCCTGGG - Intergenic
973659944 4:53094425-53094447 ATCTGTGCCCTTATTTCATAAGG + Intronic
973724104 4:53754904-53754926 GCCTTTGCCCTGAATTCAGGTGG - Intronic
976043203 4:80912807-80912829 GAGTGTGCCCACATTTCAGGAGG - Intronic
976830199 4:89307025-89307047 GTCTCTACCCTGATTTAATGTGG + Intronic
979983242 4:127282843-127282865 CCCTGTGACCTCATTTCAGGTGG + Intergenic
984018650 4:174457092-174457114 GTCTATGATTTGATTTCAGGGGG - Intergenic
985651194 5:1108550-1108572 CGTTGTGCCCAGATTTCAGGAGG - Intronic
985923579 5:2998534-2998556 ATGTGTGCCCTGAGTTCAGCGGG - Intergenic
987125652 5:14809961-14809983 GTCTGTGGCTTGAATTCAGCTGG - Intronic
987134954 5:14891787-14891809 GTCTGTGGCCTGTTAGCAGGAGG + Intergenic
988649852 5:33137433-33137455 GTCTTTGCTCTGATGTCAGATGG + Intergenic
989617427 5:43350859-43350881 GTCTCTGTCCTGGTTTTAGGTGG + Intergenic
990276543 5:54203004-54203026 TTCTATGCCATGATTTCAGGGGG + Intronic
993933931 5:93977446-93977468 GTGTGTGACTTTATTTCAGGGGG - Intronic
994245585 5:97471927-97471949 GGCTGTGCCCTGGCTCCAGGAGG + Intergenic
994690604 5:103014850-103014872 GTCTGTCCTTTGATTACAGGGGG - Intronic
998530769 5:142882450-142882472 TTCTGTGCCCTGATATTTGGTGG + Intronic
999737059 5:154520979-154521001 GCCTCTTCCCTGATGTCAGGAGG - Intergenic
999889305 5:155959364-155959386 GTCTGTAGCCTGAATTCAGCTGG + Intronic
1001374226 5:171239581-171239603 GTCTATGCCATTATTTCAGGAGG - Intronic
1003280899 6:4690487-4690509 GTCTGTGCCCAAATCTCATGTGG - Intergenic
1004980015 6:21012757-21012779 TTCTGTGCCCATATTTGAGGTGG + Intronic
1005703629 6:28429605-28429627 GTCTGTGCCCTCATCTCAGAAGG + Intergenic
1007337762 6:41166874-41166896 CTCTGTGCCCAGATGTGAGGTGG - Intergenic
1007605431 6:43114507-43114529 GGCTGTGCCCCCATTCCAGGGGG - Intronic
1008453974 6:51687020-51687042 TTTGGTGCCATGATTTCAGGAGG - Intronic
1008851504 6:56027933-56027955 TTCTTAACCCTGATTTCAGGAGG - Intergenic
1010272192 6:73927236-73927258 GTGTGTTCCCAGAATTCAGGTGG - Intergenic
1011614749 6:89187186-89187208 TTCTGTGGCCTGGTTTCTGGGGG + Intronic
1014131638 6:117840732-117840754 GTCTTTCCTCTGATGTCAGGTGG - Intergenic
1016343540 6:143086867-143086889 GGCTGTGCCATGATCTCAGCTGG + Intronic
1017175023 6:151494339-151494361 GCCAGGGCGCTGATTTCAGGAGG + Intronic
1018465991 6:164045421-164045443 GTCCCTGCCCAGATCTCAGGTGG - Intergenic
1018492701 6:164311512-164311534 GTCTTGCCCCTGATTTTAGGAGG - Intergenic
1018775843 6:167015122-167015144 GTGTGTGCCCTGACTTGAGAGGG + Intronic
1022495889 7:30852976-30852998 GGCTGTGTCCTGAGTTCAGCAGG - Intronic
1023624779 7:42105190-42105212 CTGTGTGCCCTGAATTCAAGTGG + Intronic
1025722576 7:64029803-64029825 GCCTGTGCCCTGAGTACAGTGGG - Intergenic
1025751878 7:64301021-64301043 GTCTGGGCCCTGATTACAAGGGG - Intergenic
1025787387 7:64656036-64656058 GCCTGTGTCCTGCTTTCAGGAGG + Intergenic
1025787776 7:64659206-64659228 TTCTGTGCCTTGCTTTCAGGAGG + Intergenic
1029199070 7:98826747-98826769 GTCTGTGCTGTGATTTCAGCTGG - Intergenic
1030843865 7:114385443-114385465 GGCTGTGCCATGATCTCAGCCGG + Intronic
1032260088 7:130328630-130328652 GTCTGCTCCCTGCCTTCAGGGGG - Intergenic
1035097233 7:156365542-156365564 GTGTGAGCCCTGCTTCCAGGTGG + Intergenic
1037496698 8:19447443-19447465 ATCTGAGGCCTGATTTGAGGAGG + Intronic
1041392533 8:57359721-57359743 GCCTCTGCCCAGATTTCAGAGGG + Intergenic
1041879957 8:62737796-62737818 GTTTGTGCCCTAATTGAAGGGGG - Intronic
1042985535 8:74579135-74579157 GGATGTGCTCTGATTTGAGGTGG + Intergenic
1045852476 8:106719073-106719095 GTCTTTCCCCTGATTTCTGCCGG + Intronic
1046770107 8:118110138-118110160 GTCTTTGCCATGCTTGCAGGTGG + Exonic
1047793493 8:128230654-128230676 CTCTTTGCCCTGATTCAAGGTGG + Intergenic
1051672411 9:19524221-19524243 TTCTGTGCCTTGGTTTAAGGAGG + Intronic
1051689278 9:19692280-19692302 GTCTGTTCCCAGAGTTCAAGTGG - Intronic
1052537957 9:29772036-29772058 TTCTGTCACCTGATGTCAGGTGG + Intergenic
1052721648 9:32178582-32178604 GTTTCTGCCCTGATGTAAGGTGG + Intergenic
1055420494 9:76135998-76136020 GTTTGTGCACTGCTTTAAGGAGG + Intronic
1059453771 9:114387184-114387206 GTCTGTGCCCTGCCAGCAGGTGG - Intronic
1061204751 9:129156445-129156467 GTCTGCCCCCTGATGTCTGGGGG + Intergenic
1061273445 9:129556918-129556940 GTGCGTGCTCTGATTTCAGTTGG + Intergenic
1062049986 9:134442311-134442333 GGCTGTGCCCAGAGTCCAGGGGG - Intergenic
1203769523 EBV:41791-41813 GTCTGTGTCCTGTTTTGCGGTGG + Intergenic
1203423533 Un_GL000195v1:16805-16827 GCTTGTACTCTGATTTCAGGAGG - Intergenic
1187268283 X:17757084-17757106 CCCTGTGCCCTGATTTGGGGAGG + Intergenic
1187320955 X:18237189-18237211 CCCTGTGCCCTGATTTGGGGAGG - Intergenic
1188224480 X:27580282-27580304 ATCTGTGCCCTGGTTTCAATGGG + Intergenic
1189543857 X:42021380-42021402 TGGTGTGCCCTGATTTCATGAGG - Intergenic
1190078798 X:47338768-47338790 GTCTGTGGCCTGAGTGCTGGGGG + Intergenic
1192362982 X:70450819-70450841 CTCTGTCCCCTGGTTTCTGGAGG + Intronic
1192465357 X:71351425-71351447 GTCTGGGCTCTGAAGTCAGGAGG - Intergenic
1192472932 X:71415057-71415079 GTCTGGGCTCTGAAGTCAGGAGG + Intronic
1200412482 Y:2874932-2874954 GTCTGGGCACTGATTTCTGTAGG + Intronic
1200904495 Y:8467807-8467829 GCCTGTGCCCTGTTAACAGGAGG + Intergenic