ID: 1164282037

View in Genome Browser
Species Human (GRCh38)
Location 19:23777570-23777592
Sequence CCTGCCCACAGGATGCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164282029_1164282037 6 Left 1164282029 19:23777541-23777563 CCTAGGGGATGAGAGACTCCTGC 0: 1
1: 0
2: 4
3: 48
4: 252
Right 1164282037 19:23777570-23777592 CCTGCCCACAGGATGCTTTGTGG 0: 1
1: 1
2: 1
3: 30
4: 253
1164282028_1164282037 13 Left 1164282028 19:23777534-23777556 CCTGACACCTAGGGGATGAGAGA 0: 1
1: 0
2: 1
3: 14
4: 175
Right 1164282037 19:23777570-23777592 CCTGCCCACAGGATGCTTTGTGG 0: 1
1: 1
2: 1
3: 30
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164282037 Original CRISPR CCTGCCCACAGGATGCTTTG TGG Intronic
900279980 1:1860672-1860694 GTTGCCCACAGGCTGGTTTGTGG - Intronic
900724782 1:4208791-4208813 CATACCCATAGGATGCTTTTGGG + Intergenic
901173952 1:7285016-7285038 CCCTCCCACAGGGTGCTTGGTGG + Intronic
901617968 1:10556805-10556827 CCTGTCCCCAGGGTGCTCTGAGG - Intronic
901665915 1:10826062-10826084 CCTGCCCTCAGGAAGCTGTGGGG - Intergenic
902396142 1:16133357-16133379 TCTGCCCACAGGAGAGTTTGGGG - Exonic
902536617 1:17122546-17122568 GCTGCCCACAGGCTGCTGTGGGG + Intergenic
902691386 1:18111869-18111891 CCTGCCCAAGGGATTCTTTGCGG - Intronic
903772483 1:25772647-25772669 CCTGCCCTCTGAATGCTGTGTGG + Intronic
904048128 1:27621699-27621721 CCTGGCCTCAGGGTGCCTTGGGG - Intronic
904468531 1:30722044-30722066 CCTCCTTACAGGATGTTTTGAGG + Intronic
904505511 1:30949606-30949628 CCTGCCCACAGAGTGCATTCTGG - Intronic
904720941 1:32508136-32508158 CCAGACCACAAGATACTTTGGGG - Intronic
905645878 1:39624963-39624985 CCTCCCCAGAGGCTGCATTGAGG - Exonic
905726339 1:40254952-40254974 CCTGCCAACAGCCTGTTTTGAGG + Intergenic
905945492 1:41898110-41898132 CCTGCCCCCAGGATGCTGGGAGG - Intronic
906619222 1:47260959-47260981 CCTGCCTACTTGATACTTTGTGG - Intronic
907094621 1:51766463-51766485 CCTGCCCACAGGGAACTTTTGGG + Intronic
908550856 1:65207358-65207380 CCTGCCCTCAGGAAGCTTATAGG - Intronic
911778326 1:101843234-101843256 CATGCCCACAGGTTCCTTCGAGG + Intronic
915457482 1:156050542-156050564 CCTTCCCACAGCTGGCTTTGGGG - Exonic
916089366 1:161295356-161295378 CCTTCCCACTGGATGCTTAATGG + Intergenic
917200350 1:172508127-172508149 CCTGGCCACAGGCTGATTAGAGG + Intergenic
917671090 1:177274270-177274292 CCTGCCCCCAGGATGCCTGCAGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919715876 1:200776218-200776240 CCAGCCTTCAGGTTGCTTTGTGG + Intronic
920065966 1:203269922-203269944 CCTGCCCACCGGCTGCTGTGAGG - Intronic
920504168 1:206505098-206505120 GCTGCCCAAACCATGCTTTGAGG + Intergenic
920813240 1:209306684-209306706 CTTGCTCAGAGGAGGCTTTGTGG - Intergenic
921152387 1:212412775-212412797 CCTGCGTCCAGGATGCTTTGGGG - Intronic
921726035 1:218524691-218524713 CCTGCCCACAAGAGGCTCTTGGG + Intergenic
1067093504 10:43283795-43283817 CCACCCCACAGGGTGCTGTGAGG - Intergenic
1069685175 10:70313261-70313283 CCTTCCCACAGGCTGCTCTCAGG + Intronic
1070051052 10:72890257-72890279 CTTGACCACAGGATGCACTGAGG - Intergenic
1070379466 10:75867613-75867635 CCTTCCCACTGGGTGCTTTGGGG - Intronic
1070643379 10:78184864-78184886 CCTGCCACCCGGCTGCTTTGTGG + Intergenic
1070657655 10:78282381-78282403 GGTGCCCATAGGATACTTTGTGG - Intergenic
1071816677 10:89239459-89239481 CCTGTCCACAGGATGCATTCAGG + Intronic
1073257214 10:102160566-102160588 ACCGCCCACAGGTTGCTTGGGGG - Exonic
1075524217 10:123169074-123169096 CCTGCCCACATGATACCTGGGGG - Exonic
1076685498 10:132196770-132196792 CCTGCCCACTGGAGGGTTGGGGG - Intronic
1076704631 10:132294358-132294380 CCTGCCCCAAAGATGCCTTGGGG - Intronic
1077088081 11:764613-764635 GGTGCCCCCAGGATGCTTGGTGG + Intronic
1077355774 11:2116075-2116097 CCTGACCACAGGAGGACTTGGGG + Intergenic
1078241118 11:9531426-9531448 CCTGCCCACAGGCATCTGTGAGG + Intergenic
1080587313 11:33693722-33693744 TATGCTCACAGGAGGCTTTGTGG + Intergenic
1081642496 11:44765914-44765936 CCTACTCACAGGTTGCTTTGGGG + Intronic
1082965845 11:58965422-58965444 CCAGCCAACAAGATGCTTTGTGG + Intronic
1084172402 11:67406816-67406838 CGTGGCCACAGGAGGCTGTGCGG + Exonic
1084323097 11:68384423-68384445 CATGGCCACAGGATGCTGGGAGG + Intronic
1084560966 11:69905172-69905194 CCTGCCCAGAGGACACTGTGGGG - Intergenic
1084844680 11:71889697-71889719 CCTGCCGACAGCATGATATGAGG + Intronic
1085016785 11:73178990-73179012 GCTGCCCACAGGCTGATCTGAGG + Intergenic
1085338814 11:75718135-75718157 CCTGCCCAGAGGCTTCTTGGGGG + Intronic
1087207065 11:95408014-95408036 AATGCCTACAGGAGGCTTTGTGG + Intergenic
1088543855 11:110940379-110940401 CCTGCCCTCAAGAAGCTTGGTGG - Intergenic
1089879542 11:121760443-121760465 TCTGCCCTCAGGATGCTTGAAGG + Intergenic
1089980682 11:122769587-122769609 CATCCTCACAGGATGCTCTGAGG - Intronic
1091591312 12:1844436-1844458 GCTGCCAGCAGGATGCTCTGAGG + Exonic
1096658080 12:53104075-53104097 CCTGACCACAGGATGCCTCTGGG + Intronic
1096908428 12:54958193-54958215 CCTGCACACAGCCTGCTTTGTGG + Intronic
1097287420 12:57888867-57888889 CCTTCTCACAGGGTGCTTTGAGG - Intergenic
1098080262 12:66777072-66777094 CTGTACCACAGGATGCTTTGTGG + Intronic
1098521397 12:71438705-71438727 CCTGCCTTCATGATGCTGTGAGG + Intronic
1102584276 12:113912216-113912238 CCTGCCCAGAGAATGCTCTCCGG + Intronic
1106368606 13:29108694-29108716 CCTGCCCACCAAATGCTGTGTGG - Intronic
1106949591 13:34868280-34868302 GCCGCCCACAGGAAGCTTTGGGG + Intergenic
1111795975 13:92920497-92920519 ACTGCCCACAGAATCCTTTTAGG + Intergenic
1113877841 13:113605854-113605876 CCTTCCCACAGGATCCCCTGCGG - Intronic
1113877866 13:113605960-113605982 CCTTCCCACAGGATCCCCTGCGG - Intronic
1113877877 13:113606001-113606023 CCTTCCCACAGGATCCCCTGCGG - Intronic
1113877887 13:113606042-113606064 CCTTCCCACAGGATCCCCTGCGG - Intronic
1113877917 13:113606165-113606187 CCTTCCCACAGGATCCCCTGCGG - Intronic
1116035888 14:39626855-39626877 CCTGCCCAAATGTTGCTTTTTGG + Intergenic
1120865924 14:89295114-89295136 CCTGCACCCAGGAGGCTTTTTGG + Intronic
1122027996 14:98891675-98891697 CCTGCCCGTAGGATGCATGGAGG - Intergenic
1122610165 14:102976939-102976961 CCAGCCCACAGGAGGCTTTCTGG - Intronic
1202858820 14_GL000225v1_random:68108-68130 TCTGCCTACAGGGTACTTTGTGG + Intergenic
1202861539 14_GL000225v1_random:85810-85832 TCTGCCTACAGGGTGCTTTGTGG + Intergenic
1202867794 14_GL000225v1_random:134343-134365 TCTGCCTACAGGAGGCTTTATGG + Intergenic
1202868868 14_GL000225v1_random:141046-141068 TCTGCCTACAGGGTGCTTTGTGG + Intergenic
1123798468 15:23797655-23797677 CCTGCCCAGAAGAGGCTTTGGGG - Intergenic
1125391332 15:39195944-39195966 CTGACCCCCAGGATGCTTTGAGG + Intergenic
1126053763 15:44710983-44711005 GCTGTCCTCAGGATGCTTTTGGG + Intronic
1127960656 15:63887946-63887968 CCTGACCACACGATGCCTCGAGG + Intergenic
1129434427 15:75526846-75526868 CCTGCCACCAGGATGCTGTCAGG + Intronic
1130540909 15:84820201-84820223 CCTGCCCCCTGGATTCTTGGAGG + Intronic
1131017260 15:89068106-89068128 GTTGCCCACAGAATGCTCTGTGG - Intergenic
1132279502 15:100601313-100601335 CCTGGCCACGTGATACTTTGCGG - Intronic
1132669551 16:1096997-1097019 CCCGCCCACAGCCTGCTTTCAGG - Intergenic
1132940974 16:2507972-2507994 CCTTCCCTCAGGCTGCTTTCCGG + Intronic
1136188605 16:28602212-28602234 CCCGCCCACAGCACGCTCTGTGG - Intergenic
1136191075 16:28615206-28615228 CCCGCCCACAGCACGCTCTGTGG - Intronic
1136361243 16:29781077-29781099 CCTGCCCACACTATGCTCTTAGG + Exonic
1136626539 16:31465286-31465308 CCTGACCACAGGCTGCTTCATGG + Intronic
1137564845 16:49526529-49526551 TGTGCCCACAGCATGCTGTGTGG - Intronic
1139489156 16:67277495-67277517 GCTGACCACAGCAGGCTTTGTGG - Exonic
1143012883 17:3875922-3875944 CCTGCCCTCTGGATGGTTTCGGG - Intronic
1143271738 17:5680841-5680863 GATTCCCACAAGATGCTTTGGGG - Intergenic
1146503311 17:33382997-33383019 CCTGCCCACAGAATGAGTTCAGG + Intronic
1148731410 17:49839063-49839085 CCTGCCCACACCATGCATGGAGG + Intronic
1148799626 17:50215176-50215198 CCTGCCTGTAGGATTCTTTGTGG - Intergenic
1148940818 17:51209633-51209655 ACTGCACACACGATGCTTTATGG + Intronic
1151662391 17:75525725-75525747 CCTGCCCACGGGCTGCTGGGCGG - Exonic
1151680262 17:75619347-75619369 CCTGCCCACAGGAGGCTTGGAGG + Intergenic
1151798340 17:76362019-76362041 CCTGCCCCCAGCATGGTTTCTGG - Intronic
1152317248 17:79588380-79588402 CCTGCCCTCAGGATGTTTTTTGG - Intergenic
1154400627 18:14033481-14033503 CCTGCCGTCAGGATGCCTGGGGG - Intergenic
1154930686 18:20992049-20992071 ACTTGCCACAGGATACTTTGTGG - Intronic
1155056548 18:22188841-22188863 CCTGCCCCCAGGATCCCTGGAGG - Intronic
1155150170 18:23116785-23116807 ACCACCCACAGGAAGCTTTGTGG + Intergenic
1155276119 18:24189380-24189402 CCTGCCCACAAGCTGCTGTCTGG - Intronic
1156293408 18:35769810-35769832 CCTGCCCCCAGGATGCACAGTGG - Intergenic
1156489988 18:37490564-37490586 CCGGCTCAGAGGAAGCTTTGAGG - Intronic
1158400245 18:57115349-57115371 ACTGCCATTAGGATGCTTTGTGG - Intergenic
1158650028 18:59275994-59276016 CCTGCCCACACGCTGCTAAGGGG + Intronic
1160288879 18:77572198-77572220 CCTGGCCACAGGAGGCTGGGTGG + Intergenic
1160340186 18:78082972-78082994 CCGTCCCACAGGAGGCTTAGTGG + Intergenic
1161080965 19:2309948-2309970 GCCCCCCACAGGATGCTGTGGGG + Intronic
1161280967 19:3445589-3445611 CCTGCACACACCATGCTGTGAGG - Intronic
1161389232 19:4012616-4012638 CCTGCCCTGGGGATGCTTTCAGG + Intronic
1162020695 19:7867145-7867167 CCTGGTCACAGGATGGTGTGAGG + Intergenic
1163849312 19:19654446-19654468 CCTGTCCCCAAGATGCTCTGAGG + Intronic
1164129003 19:22344961-22344983 CCTGCCCACATGATGGACTGTGG + Intergenic
1164249069 19:23461097-23461119 CCTGCCCACAGGGGGCATTGTGG + Intergenic
1164259841 19:23560032-23560054 CTTGCCCACAGGAGGCTTGATGG - Intronic
1164282037 19:23777570-23777592 CCTGCCCACAGGATGCTTTGTGG + Intronic
1164303404 19:23981825-23981847 CCTGTCCACAGTATGAGTTGTGG - Intergenic
1164312678 19:24059902-24059924 CCTGCCCACAGGAGGCTTTGTGG + Intronic
1164899813 19:31908991-31909013 CCTGCCCACTGGGTGCGCTGGGG - Intergenic
1164991773 19:32689682-32689704 TCTGCTCACAGGATAATTTGTGG - Intergenic
1165397247 19:35571220-35571242 GCAGCCAACAGGATACTTTGAGG - Intergenic
925045120 2:767034-767056 CCTGCCCACTGGATCCTCTGTGG - Intergenic
927914598 2:26927081-26927103 CCACCCCACAGGCTGCTGTGAGG - Intronic
929815845 2:45230811-45230833 CCTGCTGACATGTTGCTTTGGGG - Intergenic
929872944 2:45773753-45773775 GCAGCCCACAGGCTGCTGTGGGG - Intronic
930021471 2:47004432-47004454 CCTGCCCAAGGGAAGCTGTGAGG + Intronic
930203137 2:48563284-48563306 AATGCCCAGAGGATGCTCTGGGG + Intronic
932245109 2:70190438-70190460 ACTGCCCACACGATCCTGTGAGG + Intronic
932449583 2:71800853-71800875 CATCCCCACTGGAGGCTTTGGGG - Intergenic
936008712 2:108911161-108911183 CCTGCCCCTGGGATGCTTTCAGG + Intronic
936373210 2:111920010-111920032 CCTTCCCACAGGCTGCTTCTTGG - Intronic
938305695 2:130252810-130252832 CCTGCACACAAGATGCTCTCAGG - Intergenic
940465050 2:154016737-154016759 CAAGCCAACAGGATGATTTGAGG + Intronic
941840728 2:170080895-170080917 CCTGGCCAACGGATTCTTTGTGG - Intronic
942298000 2:174535843-174535865 CTCGCCCACAGGGTGCTCTGTGG - Intergenic
945163988 2:206922782-206922804 CATGCCCACAAGATGCTCTGTGG + Intergenic
949057235 2:241934745-241934767 CCTGCCCACAGGGTGACCTGTGG - Intergenic
1170114295 20:12839816-12839838 CCAGCTCACAGGTTGCTATGAGG + Intergenic
1172520878 20:35564764-35564786 CCAGCCCACAGTTTGCTCTGTGG + Intergenic
1172759191 20:37310069-37310091 CCTCCCCACTGGCTGCTCTGTGG - Intronic
1173414058 20:42840072-42840094 CCTGCCAACACCATGCTTTCAGG - Intronic
1173580485 20:44143413-44143435 CCTGCCCAGAGCCTGCTCTGAGG + Intronic
1173790286 20:45823844-45823866 CCTGCCCCCAGGAGACTATGGGG + Intronic
1173898766 20:46571682-46571704 CATGCCCACAGGATCATTTGGGG + Intronic
1174955219 20:55090429-55090451 CCTGCCACCAGGAGCCTTTGGGG - Intergenic
1175867040 20:62184390-62184412 CATGCTCACAGGAGGATTTGAGG + Intronic
1176027084 20:62991298-62991320 CCTGCCCACACCTTGATTTGGGG - Intergenic
1176376744 21:6090510-6090532 CCTGCCCACAGCTTAATTTGGGG + Intergenic
1176637772 21:9264603-9264625 CCTGCCAGCAGGTTGCATTGAGG - Intergenic
1179746731 21:43447734-43447756 CCTGCCCACAGCTTAATTTGGGG - Intergenic
1179773895 21:43646924-43646946 CCTGCCTTCAGGGTGCTTTTAGG - Intronic
1179924739 21:44528263-44528285 CCTGCCCGCTGCTTGCTTTGGGG + Intronic
1180421812 22:12872100-12872122 CCTGCCAGCAGGTTGCATTGAGG - Intergenic
1180702238 22:17787837-17787859 CCTGCCCAGATGATGCCTTCAGG - Exonic
1181107520 22:20583855-20583877 GCTGGCCACAGGCTGCTGTGAGG + Intronic
1184361843 22:44023853-44023875 CCTACCCACGGGAAGCTTAGAGG - Intronic
1184825256 22:46946275-46946297 GCTGCACAGAGGATGCTGTGTGG + Intronic
1184945079 22:47796892-47796914 CCTGCCTGCAGGATGCCTTTTGG + Intergenic
1185057616 22:48589132-48589154 CCTGCCCGCTGGTTGCCTTGGGG + Intronic
1185071301 22:48658217-48658239 CCTGCCCTCAGGAGTGTTTGTGG - Intronic
1185411091 22:50683542-50683564 ACTGCCCACAGGAGGTGTTGGGG + Intergenic
950009374 3:9712000-9712022 ACTGCCCGCAGGGAGCTTTGGGG - Intronic
950270816 3:11613475-11613497 CCTGCCCACAGGCTGCCTAATGG + Intronic
950480491 3:13240643-13240665 CCTGCTCTCAGGATGTTCTGTGG - Intergenic
952129477 3:30343913-30343935 CCTGCCCAAAGAATGTTTGGAGG - Intergenic
952278857 3:31903967-31903989 GCTGCCCACAGAATCCTTTGAGG - Intronic
952424991 3:33166635-33166657 CCTGCCCACAGCATGGTGTATGG + Intronic
952758508 3:36893212-36893234 CCTGTCCTCAGCAGGCTTTGAGG - Intronic
954763682 3:52896240-52896262 CCTGCAGAAAGTATGCTTTGGGG - Intronic
956233090 3:67039326-67039348 TCTGCCCTCAGGATGCTACGAGG - Intergenic
957044325 3:75362239-75362261 CCTGCCGACAGCATGATGTGAGG - Intergenic
957291567 3:78283401-78283423 CCTGCCATCATGATGCTATGTGG - Intergenic
958786078 3:98597555-98597577 CCTGCCTCCATGATGCTTTCAGG + Intergenic
961638862 3:128352239-128352261 CATTCCTACAGGATGCTGTGAGG - Intronic
965418971 3:168432798-168432820 CCTGCCCTCAGGCCACTTTGTGG + Intergenic
966865962 3:184259436-184259458 CCTGACCCCAGGAGGCTTTCTGG - Exonic
968273426 3:197422367-197422389 CCAGCACACAGGAGGCTCTGAGG + Intergenic
1202749123 3_GL000221v1_random:140418-140440 CCTGCCAGCAGGTTGCATTGAGG + Intergenic
968456308 4:702156-702178 CCTGCCCTAAAAATGCTTTGTGG - Intergenic
970426076 4:15947480-15947502 GCTGCCCCTAGGGTGCTTTGAGG - Intergenic
972221205 4:36957614-36957636 CCTTACCACAAGATGCTCTGGGG + Intergenic
976316422 4:83663842-83663864 CCTTGCCACAGGGTTCTTTGGGG - Intergenic
980083230 4:128366120-128366142 CCTGCATACAGAATGATTTGGGG - Intergenic
984959527 4:185082121-185082143 CCTGCACCCAGGCTGCTTAGTGG - Intergenic
985814137 5:2114009-2114031 ACAGCCCACAGGATGCTAAGTGG - Intergenic
986084978 5:4435767-4435789 CCTGGCCACAGAATTCTTTGTGG - Intergenic
986418741 5:7554968-7554990 CCTCCCCACAAGATGCTTGAAGG + Intronic
987809624 5:22817787-22817809 CCTCCCTACAGAATGCATTGGGG - Intronic
988622069 5:32833223-32833245 CTTTCCCACAGAATGCTTTCTGG - Intergenic
989615035 5:43330657-43330679 CCATCCCACAGCATGCTTTAAGG - Intergenic
990311097 5:54539619-54539641 CCTGCCCTGACGGTGCTTTGTGG + Intronic
991551789 5:67844994-67845016 CCTGCCCACATGCTACTTTATGG + Intergenic
992316901 5:75565819-75565841 CCTGCCATCAGGAGGCATTGGGG + Intronic
994314754 5:98319673-98319695 CCTGCTGACATGATGATTTGTGG + Intergenic
994785264 5:104151870-104151892 CTTCCTCACAGTATGCTTTGAGG - Intergenic
995544068 5:113212754-113212776 CCTGCCCACAGGGAGCTCAGAGG + Intronic
995834483 5:116386616-116386638 CCTGCTCAAAGAATGCTTTTTGG - Intronic
997529662 5:134573997-134574019 CCTGCCCTCAGGGAGCTTTCTGG + Intronic
998045381 5:138982821-138982843 CCCGCCAAGAGGATGCTTTTTGG - Intronic
1001474944 5:172043977-172043999 CCTGCACACAGGAGCCTGTGCGG + Exonic
1002875798 6:1207833-1207855 CCTGGACATAGGATGCTTCGGGG - Intergenic
1003124999 6:3349031-3349053 CCTGCTCAGGGGAGGCTTTGTGG - Intronic
1005808914 6:29501536-29501558 CCTGCCCAGTGGATACTGTGTGG + Intergenic
1005879230 6:30042277-30042299 CCTGCACACAGGAGTCTCTGTGG + Intergenic
1006277504 6:33017376-33017398 CCTGCCCACCATATACTTTGAGG - Intergenic
1006741883 6:36314699-36314721 CCTGCCCACAGGATGCTCACAGG - Intergenic
1007519861 6:42443573-42443595 CCAGTTCACAGGATTCTTTGTGG + Intronic
1007702670 6:43773747-43773769 CATGCCCACAGGTTGCTTAGAGG - Intronic
1007930888 6:45689783-45689805 TCTGCACACAGGAGGCTGTGGGG - Intergenic
1009455200 6:63848597-63848619 CCTAGCCACAGGAAGCTGTGAGG + Intronic
1011143935 6:84191199-84191221 CCTGCCCACAGGTAGCTTTAAGG - Intronic
1011344687 6:86355997-86356019 TCTGACCACAGGATTCTGTGGGG - Intergenic
1013293061 6:108735398-108735420 TCAGGCCACAGAATGCTTTGTGG - Intergenic
1017257969 6:152355521-152355543 CCTGCCCACCAGGTGCTCTGAGG + Intronic
1018427042 6:163692439-163692461 CCTGTCCCCAGGATGTTTAGCGG - Intergenic
1018590138 6:165410694-165410716 CCTGCTAACAGGATGCACTGAGG + Intronic
1018803154 6:167238764-167238786 CCTGCCTAGAGGCTGCTTGGAGG - Intergenic
1019333867 7:473500-473522 CCTGCCCACAAGAAGCTCTGAGG + Intergenic
1019443040 7:1056958-1056980 GCAGCCCACAGGAGGCTCTGGGG - Intronic
1020119122 7:5492854-5492876 CCTGCCCATAGCCTGATTTGGGG + Intronic
1023326885 7:39070419-39070441 CCTTCCAAAAGGCTGCTTTGTGG - Intronic
1023872576 7:44270691-44270713 CCTGTCCAGAGGACACTTTGAGG + Intronic
1025787635 7:64658126-64658148 CCTGCCCACAGGTGGCATTGCGG + Intergenic
1027352770 7:77328298-77328320 TGTGCCCACAGGATGCATTTTGG - Intronic
1029543488 7:101198354-101198376 CCTGCCCACAGGACTCTGTCCGG - Exonic
1033394691 7:140962389-140962411 GGTGCACACAGGAGGCTTTGGGG - Intergenic
1036656765 8:10681947-10681969 CCTGCCCACAGCAGCCTTGGCGG + Intronic
1038056077 8:23858998-23859020 CCTTCCCACAGGAGGATCTGGGG + Intergenic
1038208578 8:25493078-25493100 CCTGGCCATAGTAAGCTTTGTGG + Intronic
1040823515 8:51591417-51591439 GCTGAACACAGGAGGCTTTGAGG + Intronic
1041995133 8:64046249-64046271 CCTACCCACAGCATGTTCTGAGG - Intergenic
1042651080 8:71042118-71042140 CTTGTCCAGATGATGCTTTGAGG + Intergenic
1042814671 8:72865336-72865358 CCTGGGCACTAGATGCTTTGGGG - Intronic
1044553664 8:93538942-93538964 CCTGCCCCCAGCCTGCTTTTGGG - Intergenic
1045228971 8:100281978-100282000 CCTGCAGACAGGATGCATTCTGG + Intronic
1047453483 8:124988202-124988224 AGTGACCACAGGATGGTTTGGGG - Intergenic
1048963218 8:139596964-139596986 CCTGCTCAGAGGATGCCTTCAGG + Intergenic
1049449893 8:142654974-142654996 CCTGCCCCAAGGTGGCTTTGAGG + Intergenic
1049593127 8:143471590-143471612 CCTCCCCACAGAATCCTGTGTGG - Intronic
1049983335 9:924926-924948 CTTGCCCACAGTTTGCCTTGTGG - Intronic
1051727102 9:20099407-20099429 TCTGCTCACAGGTTGCTTTTTGG + Intergenic
1052864041 9:33454193-33454215 CCTGCCCTCAGCAGCCTTTGAGG + Intergenic
1056345896 9:85694475-85694497 AGTGACCACAGGATGCTTTTGGG - Intronic
1057465641 9:95311988-95312010 CCTGCCCACTGGATGCCATAAGG + Intronic
1058778650 9:108310853-108310875 TCTGCCCACATTATGCTCTGAGG + Intergenic
1059459795 9:114422463-114422485 TCTGCCCCCTGGATGCTTGGAGG - Intronic
1059499658 9:114740245-114740267 CTTTCCCATATGATGCTTTGTGG + Intergenic
1061445977 9:130638327-130638349 TTTGCCCACAAGATGCCTTGTGG - Exonic
1061608733 9:131731704-131731726 ACTGAGCACAGGATGCTGTGTGG - Intronic
1061911412 9:133727185-133727207 TCTGCCCACAGCTTCCTTTGTGG - Intronic
1061949413 9:133927881-133927903 CCTGCTCACAGGATCCTAGGAGG - Intronic
1062703591 9:137921427-137921449 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703603 9:137921541-137921563 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703609 9:137921598-137921620 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703616 9:137921655-137921677 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703622 9:137921712-137921734 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703633 9:137921826-137921848 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703645 9:137921940-137921962 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703651 9:137921997-137922019 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703657 9:137922054-137922076 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703668 9:137922167-137922189 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703674 9:137922224-137922246 TCTGCTCCCAGGATGCTTTGCGG - Intronic
1062703680 9:137922281-137922303 TCTGCTCCCAGGATGCTGTGCGG - Intronic
1062703691 9:137922394-137922416 TCTGCTCCCAGGATGCTGTGTGG - Intronic
1203736975 Un_GL000216v2:145924-145946 TCTGCCTACAGGAGGCTTTATGG - Intergenic
1203717762 Un_KI270742v1:170508-170530 CCTGCCAGCAGGTTGCATTGAGG + Intergenic
1186206750 X:7208806-7208828 CCTGCCCACACCATGATTTTAGG - Intergenic
1189128065 X:38468931-38468953 CCTACTCAAAGGATGCTTTCAGG - Intronic
1190214894 X:48473622-48473644 GCTGCCCAGGGGCTGCTTTGAGG - Intergenic
1192189507 X:68982278-68982300 TTTGCCCCCAGCATGCTTTGGGG + Intergenic
1196065703 X:111461985-111462007 CCTTCCCTCAGGAAGCTTTAGGG + Intergenic
1198469948 X:136936959-136936981 AGTACCCACAGGATGCTGTGAGG - Intergenic
1200041373 X:153372719-153372741 CCTGCACTCAGGCTGCTCTGTGG - Intergenic
1200301297 X:154979427-154979449 CCTGCCCTCAGGCTCCTTGGTGG + Intronic
1202623837 Y:56837489-56837511 TCTGCCTACAGGGGGCTTTGTGG + Intergenic